Gene detail

Detail information of GWHGAAZE007944

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010096464.1	1.42095E-41	Ethylene-responsive transcription factor [Morus notabilis]
Swissprot	tr\|Q9FH54\|EF114_ARATH	6E-36	Ethylene-responsive transcription factor ERF114
trEMBL	tr\|W9RA19\|W9RA19_9ROSA	5E-42	Ethylene-responsive transcription factor {ECO:0000313\|EMBL:EXB64474.1}
TAIR10	AT5G64750.1	8E-22	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	57040354	57040986	-
GWHAAZE00000002	mRNA	57040354	57040986	-
GWHAAZE00000002	exon	57040354	57040986	-
GWHAAZE00000002	CDS	57040354	57040986	-

Transcript Sequence
>GWHTAAZE007952 ACAAGAGAAGATTTGCCAAGAAGGAGGTATAGAGGAGTGAGGCAAAGGCCATGGGGCAAATGGGCAGCCGAAATAAGGGACCCCTACAAAGCTGCTAGGGTTTGGTTAGGCACATTTGAGACTGCTGAGGCTGCTGCCACTGCCTATGATCAAGCAGCCCTTAAATTTAGAGGCAACAAAGCCAAACTCAACTTCCCGGAAAACGTCGTACTCCAGACACCTCCGGCAACCCATTTCCCGATTTCCAATTCTTCAGCAAATCTTTTTTCAGTTTCCCCATCCCCGGCTCCCATTGTTCAGAATCGAGCAAGTTACAACCTTATGCAGCATGACACAAGTGCTTCAATGGAATATGCTAATAACATGAACTACTACTCGAATCAGTTGCTTTCGAGCTCGCAAGACTTTCAAACACAACCCGTGAATTTTTTGGATCAGTTACAATTTTCTGCTTCACTGGATTGTACTTTCGAATCTTCTCCTTCATCTTCGTCACTTGGGTACTCTTTTTCATCATCATCTCCACCACCTCCGACTGTGATGCCACCTACTTTTGGGCTTTTTCCAACAGAGCCATCAGTTAGGAATACAACATGGTCGGATTCAAGTCATCATCAGCCTCCATCTTCATGA

Network for GWHGAAZE007944

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	9	58	1.70E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.209
	SRR3591706	second leaf	0.120
	SRR3591707	mature leaf	0.738
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.371
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.285
	SRR3591712	Green floral bud	0.075
	SRR3591713	Yellow flower	0.040
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.163
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.034
	SRR8316904	Silver flowering stage	0.204
	SRR8316905	Silver flowering stage	0.170
	SRR8316906	Gold flowering stage	0.734
	SRR8316907	Gold flowering stage	0.459
	SRR8316908	Gold flowering stage	1.439
SRP132670	SRR6706286	Control	0.025
	SRR6706287	Light intensity 50%	0.100
	SRR6706288	Light intensity 20%	0.085
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.343
	CNS0095593	Slightly white alabastrum(diploid) 2	0.989
	CNS0095594	Slightly white alabastrum(diploid) 3	1.226
	CNS0095595	Whole white alabastrum(diploid) 2	0.704
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.393
	CNS0095598	Silvery flower (diploied) 1	0.462
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.939
	CNS0095601	Golden flower (diploid) 1	0.093
	CNS0095602	Golden flower (diploid) 2	0.233
	CNS0095603	Golden flower (diploid) 3	0.542
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.063
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.009
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.625
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.097
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.686
	CNS0095613	Golden flower (tetraploid) 1	0.139
	CNS0095614	Golden flower (tetraploid) 2	0.525
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	2.565
	CRR073298	Stem 2	1.306
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.119
	CRR073301	Leaf 2	0.493
	CRR073302	Leaf 3	0.244
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.196
	CRR073306	Third green 1	1.313
	CRR073307	Third green 2	0.311
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.185
	CRR073310	Second white 2	0.730
	CRR073311	Second white 3	0.169
	CRR073312	Silver flowering 1	0.703
	CRR073313	Silver flowering 2	0.220
	CRR073314	Silver flowering 3	0.264
	CRR073315	Gold flowering 1	0.131
	CRR073316	Gold flowering 2	3.000
	CRR073317	Gold flowering 3	0.174
	CRR073318	Tawny withering 1	0.068
	CRR073319	Tawny withering 2	2.340
	CRR073320	Tawny withering 3	0.000