Gene detail

Detail information of GWHGAAZE007943

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010096464.1	2.47319E-46	Ethylene-responsive transcription factor [Morus notabilis]
Swissprot	tr\|Q9FH54\|EF114_ARATH	5E-35	Ethylene-responsive transcription factor ERF114
trEMBL	tr\|W9RA19\|W9RA19_9ROSA	9E-47	Ethylene-responsive transcription factor {ECO:0000313\|EMBL:EXB64474.1}
TAIR10	AT5G61890.1	2E-29	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	56990109	56990576	-
GWHAAZE00000002	mRNA	56990109	56990576	-
GWHAAZE00000002	exon	56990109	56990576	-
GWHAAZE00000002	CDS	56990109	56990576	-

Transcript Sequence
>GWHTAAZE007951 ACAAGCACATTCATATATACACCAACATACTCAAATAGTGAGCCAGCGAGAGAAGAATTACGAAGAAAAAGGTATAGAGGAGTAAGGCAAAGGCCATGGGGCAAATGGGCAGCCGAAATAAGGGACCCCTACAAGGCTGCTAGGGTTTGGTTAGGCACATTTGACACTCCCGAGGCTGCTGCCATTGCCTATGATCAAGCAGCCCTGAAATTCAGGGGCAAAAAAGCCAAACTCAACTTCCCTGAAAACGTTGTACTCCAGCCACCTCCGTCCATTGCACCGTCGACCCATTTCCAGGTTTCCAATTATCCGGCAACCCTTTCCTCAGTTTCCACATCCCCAGCTCCGATCGTTCACACTCATGCAAATTACAACCCTGTGCAGGAGGGGACTAGTGCTTCAATGGACTTTACCAACATCAACTACTACTCAAATTCGCACGATTTTCAAAGACAACCCACAAATTTG

Network for GWHGAAZE007943

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	24	73	1.00E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.465
	SRR3591711	White flower	1.953
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.859
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.072
	SRR8316900	Third green stage	0.094
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.942
	SRR8316907	Gold flowering stage	0.650
	SRR8316908	Gold flowering stage	0.129
SRP132670	SRR6706286	Control	0.010
	SRR6706287	Light intensity 50%	0.015
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.081
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.141
	CNS0095595	Whole white alabastrum(diploid) 2	0.234
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.375
	CNS0095598	Silvery flower (diploied) 1	0.015
	CNS0095599	Silvery flower (diploied) 2	0.476
	CNS0095600	Silvery flower (diploied) 3	0.101
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.233
	CNS0095603	Golden flower (diploid) 3	0.568
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.134
	CNS0095611	Silvery flower (tetraploid) 2	0.181
	CNS0095612	Silvery flower (tetraploid) 3	0.145
	CNS0095613	Golden flower (tetraploid) 1	0.312
	CNS0095614	Golden flower (tetraploid) 2	0.141
	CNS0095615	Golden flower (tetraploid) 3	0.463
CRA001975	CRR073297	Stem 1	0.200
	CRR073298	Stem 2	0.255
	CRR073299	Stem 3	0.011
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.132
	CRR073302	Leaf 3	0.080
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.109
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.125
	CRR073311	Second white 3	0.043
	CRR073312	Silver flowering 1	0.662
	CRR073313	Silver flowering 2	0.104
	CRR073314	Silver flowering 3	0.197
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.157
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	1.651
	CRR073320	Tawny withering 3	0.000