Gene detail

Detail information of GWHGAAZE007911

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO59945.1	1.98282E-71	hypothetical protein CISIN_1g027605mg [Citrus sinensis]
Swissprot	tr\|O23310\|NFYB3_ARATH	3E-60	Nuclear transcription factor Y subunit B-3
trEMBL	tr\|A0A067F1F4\|A0A067F1F4_CITSI	7E-72	Uncharacterized protein {ECO:0000313\|EMBL:KDO59945.1}
TAIR10	AT4G14540.1	3E-48	nuclear factor Y, subunit B3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	56244142	56244669	-
GWHAAZE00000002	mRNA	56244142	56244669	-
GWHAAZE00000002	exon	56244142	56244669	-
GWHAAZE00000002	CDS	56244142	56244669	-

Transcript Sequence
>GWHTAAZE007919 ATGACAGGAAAAAGAACAACCCAAACAAGCCCCACTTCTAGCCCAACATACGGCAACATCTCTGACAAGGACCTCGATCGCTTCCTCCCCATTGCTAACGTGAGCCGGATCATGAAAAAATCACTACCCACAAACGCAAAGATCTCGAAAGAAGCAAAAGAAACTGTCCAAGAATGCGTGTCGGAGTTCATTAGCTTCATCACCGGCGAGGCCTCCGACAAGTGCCAGAGAGAGAAGCGAAAGACGATCAACGGGGACGATCTCTTGTGGGCCATGACCACTCTAGGGTTTGAGAATTATGTTAACCCTTTGAAGGTTTATTTGAATAAGTATAGGGAGATTGAAGTGGAGAAAGTTGGTGAACCTATTGGTGATAGTGGAAGGGAGTTTGAAAAGAGGTATGATGATGGCTATTATGGGCCTGGTGCGCAGGTTAGCCCCTATAGTAAGATTGGGGATGGGAATGGGAATAGGGTTATGGCTACTACTACTACTCAGTTCATCTTGGGGTCTAGTGGCAGATTTTGA

Network for GWHGAAZE007911

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00808.24	CBFD_NFYB_HMF	28	92	5.10E-27

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NF-YB

KEGG pathway

KO	Enzyme	pathway	mapID
K08065	NFYB, HAP3	Antigen processing and presentation	map04612

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0005634	cellular_component	nucleus
GO:0046982	molecular_function	protein heterodimerization activity
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.484
	SRR3591706	second leaf	3.395
	SRR3591707	mature leaf	0.360
	SRR3591708	Shoot apex	2.600
	SRR3591709	Stem	18.783
	SRR3591710	White floral bud	9.054
	SRR3591711	White flower	7.798
	SRR3591712	Green floral bud	7.976
	SRR3591713	Yellow flower	1.271
SRP173429	SRR8316895	Juvenile bud stage	1.371
	SRR8316896	Juvenile bud stage	2.608
	SRR8316897	Juvenile bud stage	0.276
	SRR8316894	Third green stage	0.728
	SRR8316900	Third green stage	3.743
	SRR8316901	Third green stage	2.387
	SRR8316898	Complete white stage	1.754
	SRR8316899	Complete white stage	3.053
	SRR8316903	Complete white stage	1.733
	SRR8316902	Silver flowering stage	2.596
	SRR8316904	Silver flowering stage	1.586
	SRR8316905	Silver flowering stage	0.999
	SRR8316906	Gold flowering stage	1.799
	SRR8316907	Gold flowering stage	8.174
	SRR8316908	Gold flowering stage	0.976
SRP132670	SRR6706286	Control	5.525
	SRR6706287	Light intensity 50%	5.539
	SRR6706288	Light intensity 20%	4.895
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.889
	CNS0095593	Slightly white alabastrum(diploid) 2	5.274
	CNS0095594	Slightly white alabastrum(diploid) 3	5.607
	CNS0095595	Whole white alabastrum(diploid) 2	1.584
	CNS0095596	Whole white alabastrum(diploid) 3	2.866
	CNS0095597	Whole white alabastrum(diploid) 4	2.483
	CNS0095598	Silvery flower (diploied) 1	3.868
	CNS0095599	Silvery flower (diploied) 2	2.720
	CNS0095600	Silvery flower (diploied) 3	3.467
	CNS0095601	Golden flower (diploid) 1	1.326
	CNS0095602	Golden flower (diploid) 2	3.990
	CNS0095603	Golden flower (diploid) 3	3.301
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.194
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.462
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.858
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.648
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.647
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.983
	CNS0095610	Silvery flower (tetraploid) 1	3.290
	CNS0095611	Silvery flower (tetraploid) 2	1.460
	CNS0095612	Silvery flower (tetraploid) 3	2.345
	CNS0095613	Golden flower (tetraploid) 1	0.575
	CNS0095614	Golden flower (tetraploid) 2	2.151
	CNS0095615	Golden flower (tetraploid) 3	1.200
CRA001975	CRR073297	Stem 1	1.192
	CRR073298	Stem 2	0.879
	CRR073299	Stem 3	1.713
	CRR073300	Leaf 1	2.535
	CRR073301	Leaf 2	2.867
	CRR073302	Leaf 3	3.176
	CRR073303	Juvenile bud 1	4.756
	CRR073304	Juvenile bud 2	1.390
	CRR073305	Juvenile bud 3	2.040
	CRR073306	Third green 1	36.332
	CRR073307	Third green 2	30.109
	CRR073308	Third green 3	31.273
	CRR073309	Second white 1	4.926
	CRR073310	Second white 2	1.219
	CRR073311	Second white 3	0.952
	CRR073312	Silver flowering 1	1.226
	CRR073313	Silver flowering 2	0.172
	CRR073314	Silver flowering 3	0.772
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.050
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	6.939
	CRR073319	Tawny withering 2	5.393
	CRR073320	Tawny withering 3	4.106