Gene detail

Detail information of GWHGAAZE007864

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007047943.1	1.7893E-65	Ribosomal L29 family protein [Theobroma cacao]
Swissprot	tr\|Q9FJP3\|RK29_ARATH	4E-53	50S ribosomal protein L29, chloroplastic (Precursor)
trEMBL	tr\|A0A061DI09\|A0A061DI09_THECC	7E-66	Ribosomal L29 family protein {ECO:0000313\|EMBL:EOX92100.1}
TAIR10	AT5G65220.1	2E-38	Ribosomal L29 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	54677559	54681472	-
GWHAAZE00000002	mRNA	54677559	54681472	-
GWHAAZE00000002	exon	54681143	54681472	-
GWHAAZE00000002	exon	54677559	54677738	-
GWHAAZE00000002	CDS	54681143	54681472	-
GWHAAZE00000002	CDS	54677559	54677738	-

Transcript Sequence
>GWHTAAZE007872 ATGTCCATAGCTTCCTCTTCCAACCTCACCTTCTCCTCCTTAAACAACCTCTTCTCTTCTTCAAAACCCAAATCTCAATTTCATGGCATTCGAATTCCCCAAGTTTGCCCCAAACCCATTCCTTCAATTCGAGCAACCCCCAAGAATTCAGCTTCTTCGGTGGTGATGATGGCAAAGAGAGAAGAAGAATTGAAACAGATAAGACTCAAAACCACCGAACAAATCAATGAAGAAATCATTGATCTTAAAGGAGAGCTGTTTATGCTTCGTCTTCAGAGGTCTGCTCGTAATGAGTTCAAGTCCAGTGAGTTTCGCCGTATGCGCAAAACGGTTGCACGTATGCTGACGGTTAAGCGGGAGAGAGAGTTAGAGGAAGGAATAAACAAGAGGATATCGAGAAAGCTTGATCGTCAATGGAGGAAGAGCATTGTTGTAAGACCACCTCCATCCCTTCTTAGGCTAAGAGAGGAAGAGGCAGCTGAAGAAGCTAAGAAATCATCTGCTGCATGA

Network for GWHGAAZE007864

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00831.24	Ribosomal_L29	65	121	1.20E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02904	RP-L29, rpmC	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	106.102
	SRR3591706	second leaf	328.593
	SRR3591707	mature leaf	182.853
	SRR3591708	Shoot apex	291.552
	SRR3591709	Stem	33.901
	SRR3591710	White floral bud	74.133
	SRR3591711	White flower	82.880
	SRR3591712	Green floral bud	110.055
	SRR3591713	Yellow flower	71.660
SRP173429	SRR8316895	Juvenile bud stage	87.050
	SRR8316896	Juvenile bud stage	85.866
	SRR8316897	Juvenile bud stage	56.272
	SRR8316894	Third green stage	44.457
	SRR8316900	Third green stage	137.436
	SRR8316901	Third green stage	114.094
	SRR8316898	Complete white stage	24.227
	SRR8316899	Complete white stage	71.090
	SRR8316903	Complete white stage	27.254
	SRR8316902	Silver flowering stage	13.307
	SRR8316904	Silver flowering stage	15.381
	SRR8316905	Silver flowering stage	6.962
	SRR8316906	Gold flowering stage	18.233
	SRR8316907	Gold flowering stage	20.982
	SRR8316908	Gold flowering stage	25.405
SRP132670	SRR6706286	Control	114.928
	SRR6706287	Light intensity 50%	108.465
	SRR6706288	Light intensity 20%	131.252
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	96.950
	CNS0095593	Slightly white alabastrum(diploid) 2	78.101
	CNS0095594	Slightly white alabastrum(diploid) 3	66.028
	CNS0095595	Whole white alabastrum(diploid) 2	77.622
	CNS0095596	Whole white alabastrum(diploid) 3	88.704
	CNS0095597	Whole white alabastrum(diploid) 4	59.982
	CNS0095598	Silvery flower (diploied) 1	66.900
	CNS0095599	Silvery flower (diploied) 2	70.470
	CNS0095600	Silvery flower (diploied) 3	36.546
	CNS0095601	Golden flower (diploid) 1	54.362
	CNS0095602	Golden flower (diploid) 2	34.642
	CNS0095603	Golden flower (diploid) 3	36.823
	CNS0095604	Slightly white alabastrum(tetraploid) 1	60.937
	CNS0095605	Slightly white alabastrum(tetraploid) 2	70.038
	CNS0095606	Slightly white alabastrum(tetraploid) 3	83.001
	CNS0095607	Whole white alabastrum(tetraploid) 1	26.852
	CNS0095608	Whole white alabastrum(tetraploid) 2	41.253
	CNS0095609	Whole white alabastrum(tetraploid) 3	73.244
	CNS0095610	Silvery flower (tetraploid) 1	39.755
	CNS0095611	Silvery flower (tetraploid) 2	50.172
	CNS0095612	Silvery flower (tetraploid) 3	40.418
	CNS0095613	Golden flower (tetraploid) 1	21.224
	CNS0095614	Golden flower (tetraploid) 2	26.865
	CNS0095615	Golden flower (tetraploid) 3	14.200
CRA001975	CRR073297	Stem 1	145.823
	CRR073298	Stem 2	135.992
	CRR073299	Stem 3	191.343
	CRR073300	Leaf 1	94.543
	CRR073301	Leaf 2	92.062
	CRR073302	Leaf 3	143.589
	CRR073303	Juvenile bud 1	113.715
	CRR073304	Juvenile bud 2	125.062
	CRR073305	Juvenile bud 3	73.268
	CRR073306	Third green 1	45.983
	CRR073307	Third green 2	26.570
	CRR073308	Third green 3	33.569
	CRR073309	Second white 1	19.107
	CRR073310	Second white 2	19.637
	CRR073311	Second white 3	8.835
	CRR073312	Silver flowering 1	10.062
	CRR073313	Silver flowering 2	16.223
	CRR073314	Silver flowering 3	10.333
	CRR073315	Gold flowering 1	414.590
	CRR073316	Gold flowering 2	438.175
	CRR073317	Gold flowering 3	326.864
	CRR073318	Tawny withering 1	56.574
	CRR073319	Tawny withering 2	61.136
	CRR073320	Tawny withering 3	56.430