Gene detail

Detail information of GWHGAAZE007843

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010917301.1	3.6053E-109	PREDICTED: serine/threonine-protein kinase SAPK2 [Elaeis guineensis]
Swissprot	tr\|A2YNT8\|SAPK2_ORYSI	6E-103	Serine/threonine-protein kinase SAPK2
trEMBL	tr\|A0A061DHQ0\|A0A061DHQ0_THECC	2E-105	Serine/threonine-protein kinase SRK2E {ECO:0000313\|EMBL:EOX92029.1}
TAIR10	AT4G33950.1	2E-73	Protein kinase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	54075380	54078457	+
GWHAAZE00000002	mRNA	54075380	54078457	+
GWHAAZE00000002	exon	54075380	54075502	+
GWHAAZE00000002	exon	54075860	54075952	+
GWHAAZE00000002	exon	54077075	54077179	+
GWHAAZE00000002	exon	54077424	54077522	+
GWHAAZE00000002	exon	54078152	54078457	+
GWHAAZE00000002	CDS	54075380	54075502	+
GWHAAZE00000002	CDS	54075860	54075952	+
GWHAAZE00000002	CDS	54077075	54077179	+
GWHAAZE00000002	CDS	54077424	54077522	+
GWHAAZE00000002	CDS	54078152	54078457	+

Transcript Sequence
>GWHTAAZE007851 ATGTTGTGTATCACTGTGCAGGTATTGCTAACACCGGATCATTTAGCTATAGTCATGGAATATGCATCGGGAGGAGAACTTTTTGAGAGGATATGCAATGCTGGTAGATTCAGTGAAGACGAGCAAATTTGCCATAGAGATCTCAAGCTAGAAAACACACTCCTAGATGGGAACTCTCCGCCGCGCCTTAAAATATGTGACTTTGGATATTCCAAGATTGCGGATGTTTGGTCTTGTGGTGTTACCTTATATGTGATGCTGGTTGGTGCTTATCCATTTGAAGATTCTGATGATCCAGTAAATTTCAGGAAAACTATTAATCGCATACTTAATGTCCAATATTCAATCCCTGACTATGTCCGCGTATCAATGGACTGCCGACATCTTCTATCTCGAATATTTGTAGCTAACCCTGAAAAGAGAATAAGTATACCAGAAATTCAAGAGCACCCATGGTTCTTGAAGAACTTACCAAAAGAATTCATGGAAGGAGAGGAAGATGGATTTCAAAATAACAATAGTAATGAAACAAATAATCCATCACAGAGCATTGAAGAAGTGATAACAATAATACAAGAAGCAAGGAAGCCAATAAAGGGGGGCCCTAAAATTGAAGGGCAGTTTGTTGGTGGGGGAGGAAGTATGGACATTGATGATGAAATAGACACTGATGCTGATCTAGATGATGAAACTGAGACAAGTGGGGATTTTGTTTGCTCTTTGTAA

Network for GWHGAAZE007843

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	70	153	2.00E-14

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	CAMK_OST1L

KEGG pathway

KO	Enzyme	pathway	mapID
K14498	SNRK2	MAPK signaling pathway - plant	map04016
K14498	SNRK2	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	59.532
	SRR3591706	second leaf	15.947
	SRR3591707	mature leaf	63.635
	SRR3591708	Shoot apex	14.517
	SRR3591709	Stem	65.895
	SRR3591710	White floral bud	40.074
	SRR3591711	White flower	91.284
	SRR3591712	Green floral bud	29.265
	SRR3591713	Yellow flower	47.266
SRP173429	SRR8316895	Juvenile bud stage	10.659
	SRR8316896	Juvenile bud stage	29.033
	SRR8316897	Juvenile bud stage	10.374
	SRR8316894	Third green stage	14.412
	SRR8316900	Third green stage	42.439
	SRR8316901	Third green stage	55.577
	SRR8316898	Complete white stage	18.192
	SRR8316899	Complete white stage	28.521
	SRR8316903	Complete white stage	25.483
	SRR8316902	Silver flowering stage	50.899
	SRR8316904	Silver flowering stage	75.480
	SRR8316905	Silver flowering stage	44.368
	SRR8316906	Gold flowering stage	91.392
	SRR8316907	Gold flowering stage	131.266
	SRR8316908	Gold flowering stage	88.853
SRP132670	SRR6706286	Control	8.408
	SRR6706287	Light intensity 50%	11.064
	SRR6706288	Light intensity 20%	11.227
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	30.374
	CNS0095593	Slightly white alabastrum(diploid) 2	40.902
	CNS0095594	Slightly white alabastrum(diploid) 3	35.387
	CNS0095595	Whole white alabastrum(diploid) 2	32.787
	CNS0095596	Whole white alabastrum(diploid) 3	46.219
	CNS0095597	Whole white alabastrum(diploid) 4	43.818
	CNS0095598	Silvery flower (diploied) 1	54.882
	CNS0095599	Silvery flower (diploied) 2	43.804
	CNS0095600	Silvery flower (diploied) 3	102.608
	CNS0095601	Golden flower (diploid) 1	35.812
	CNS0095602	Golden flower (diploid) 2	79.207
	CNS0095603	Golden flower (diploid) 3	79.594
	CNS0095604	Slightly white alabastrum(tetraploid) 1	18.577
	CNS0095605	Slightly white alabastrum(tetraploid) 2	22.666
	CNS0095606	Slightly white alabastrum(tetraploid) 3	13.817
	CNS0095607	Whole white alabastrum(tetraploid) 1	18.396
	CNS0095608	Whole white alabastrum(tetraploid) 2	20.184
	CNS0095609	Whole white alabastrum(tetraploid) 3	33.962
	CNS0095610	Silvery flower (tetraploid) 1	79.429
	CNS0095611	Silvery flower (tetraploid) 2	28.226
	CNS0095612	Silvery flower (tetraploid) 3	24.517
	CNS0095613	Golden flower (tetraploid) 1	35.739
	CNS0095614	Golden flower (tetraploid) 2	29.895
	CNS0095615	Golden flower (tetraploid) 3	21.659
CRA001975	CRR073297	Stem 1	8.569
	CRR073298	Stem 2	7.076
	CRR073299	Stem 3	3.689
	CRR073300	Leaf 1	12.539
	CRR073301	Leaf 2	11.908
	CRR073302	Leaf 3	9.599
	CRR073303	Juvenile bud 1	10.232
	CRR073304	Juvenile bud 2	9.957
	CRR073305	Juvenile bud 3	7.859
	CRR073306	Third green 1	7.303
	CRR073307	Third green 2	15.888
	CRR073308	Third green 3	9.993
	CRR073309	Second white 1	10.161
	CRR073310	Second white 2	9.105
	CRR073311	Second white 3	6.172
	CRR073312	Silver flowering 1	3.493
	CRR073313	Silver flowering 2	1.745
	CRR073314	Silver flowering 3	4.230
	CRR073315	Gold flowering 1	16.333
	CRR073316	Gold flowering 2	27.502
	CRR073317	Gold flowering 3	5.773
	CRR073318	Tawny withering 1	6.555
	CRR073319	Tawny withering 2	10.556
	CRR073320	Tawny withering 3	13.344