Gene detail

Detail information of GWHGAAZE007680

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002521730.1	2.358E-106	50S robosomal protein L11, putative [Ricinus communis]
Swissprot	tr\|O78412\|RK11_GUITH	8E-30	50S ribosomal protein L11, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_00736}
trEMBL	tr\|B9S6W1\|B9S6W1_RICCO	9E-107	50S robosomal protein L11, putative {ECO:0000313\|EMBL:EEF40717.1}
TAIR10	AT4G35490.1	5E-62	mitochondrial ribosomal protein L11

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	50110095	50110562	-
GWHAAZE00000002	mRNA	50110095	50110562	-
GWHAAZE00000002	exon	50110095	50110562	-
GWHAAZE00000002	CDS	50110095	50110562	-

Transcript Sequence
>GWHTAAZE007688 ATGGCAACCCTAAAAGAAATCCTAACTCGCCGTCCGGTAGCAGCAACAATCCGCCTCACCGTCCCTGCCGGCGGAGCACGGCCAGCACCACCCGTCGGTCCAGCCCTAGGTCAATACCGCCTAAACCTAATGGCATTTTGCAAGGACTTCAACGCACGTACTCAAAAATACAAGCCGGATACACCAATGTCGGTCACAATCACCGCCTTCAAAGACAATACCTTCGAGTTCACCGTCAAATCGCCATCGGTCACCTGGTATTTGAAGAAAGCCGCCGGTATAGAGTCCGGTAGTAGTCGGCCCGGTCATGTCGTTGCTTCTACTTTGACGGTGAAGCATGTTTATGAGATTGCGAAGGTAAAGCAGTCTGATCCTTATTGTCAGTATATGTCTTTGGAGGCTATTAGTAAGTCAGTTATTGGTACTGCTAATAGTATGGGGATTCAGGTTCAAAAGGAGTTGGATTGA

Network for GWHGAAZE007680

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03946.15	Ribosomal_L11_N	13	75	1.70E-24
PF00298.20	Ribosomal_L11	80	150	1.70E-27

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02867	RP-L11, MRPL11, rplK	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	32.392
	SRR3591706	second leaf	25.817
	SRR3591707	mature leaf	13.695
	SRR3591708	Shoot apex	35.103
	SRR3591709	Stem	21.312
	SRR3591710	White floral bud	9.421
	SRR3591711	White flower	12.733
	SRR3591712	Green floral bud	25.290
	SRR3591713	Yellow flower	10.386
SRP173429	SRR8316895	Juvenile bud stage	20.311
	SRR8316896	Juvenile bud stage	32.032
	SRR8316897	Juvenile bud stage	14.186
	SRR8316894	Third green stage	11.402
	SRR8316900	Third green stage	34.257
	SRR8316901	Third green stage	31.918
	SRR8316898	Complete white stage	4.371
	SRR8316899	Complete white stage	24.802
	SRR8316903	Complete white stage	8.679
	SRR8316902	Silver flowering stage	7.096
	SRR8316904	Silver flowering stage	8.184
	SRR8316905	Silver flowering stage	3.642
	SRR8316906	Gold flowering stage	10.173
	SRR8316907	Gold flowering stage	12.484
	SRR8316908	Gold flowering stage	15.367
SRP132670	SRR6706286	Control	19.120
	SRR6706287	Light intensity 50%	21.535
	SRR6706288	Light intensity 20%	21.898
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	36.026
	CNS0095593	Slightly white alabastrum(diploid) 2	40.411
	CNS0095594	Slightly white alabastrum(diploid) 3	43.849
	CNS0095595	Whole white alabastrum(diploid) 2	34.955
	CNS0095596	Whole white alabastrum(diploid) 3	37.616
	CNS0095597	Whole white alabastrum(diploid) 4	36.349
	CNS0095598	Silvery flower (diploied) 1	24.190
	CNS0095599	Silvery flower (diploied) 2	28.631
	CNS0095600	Silvery flower (diploied) 3	16.849
	CNS0095601	Golden flower (diploid) 1	13.594
	CNS0095602	Golden flower (diploid) 2	24.869
	CNS0095603	Golden flower (diploid) 3	20.497
	CNS0095604	Slightly white alabastrum(tetraploid) 1	33.026
	CNS0095605	Slightly white alabastrum(tetraploid) 2	28.262
	CNS0095606	Slightly white alabastrum(tetraploid) 3	30.590
	CNS0095607	Whole white alabastrum(tetraploid) 1	18.986
	CNS0095608	Whole white alabastrum(tetraploid) 2	16.658
	CNS0095609	Whole white alabastrum(tetraploid) 3	24.665
	CNS0095610	Silvery flower (tetraploid) 1	13.246
	CNS0095611	Silvery flower (tetraploid) 2	15.250
	CNS0095612	Silvery flower (tetraploid) 3	13.483
	CNS0095613	Golden flower (tetraploid) 1	11.267
	CNS0095614	Golden flower (tetraploid) 2	14.679
	CNS0095615	Golden flower (tetraploid) 3	13.708
CRA001975	CRR073297	Stem 1	14.779
	CRR073298	Stem 2	17.861
	CRR073299	Stem 3	21.978
	CRR073300	Leaf 1	13.353
	CRR073301	Leaf 2	16.426
	CRR073302	Leaf 3	21.864
	CRR073303	Juvenile bud 1	17.852
	CRR073304	Juvenile bud 2	13.616
	CRR073305	Juvenile bud 3	14.644
	CRR073306	Third green 1	4.801
	CRR073307	Third green 2	4.825
	CRR073308	Third green 3	2.847
	CRR073309	Second white 1	5.522
	CRR073310	Second white 2	5.442
	CRR073311	Second white 3	3.282
	CRR073312	Silver flowering 1	4.415
	CRR073313	Silver flowering 2	6.893
	CRR073314	Silver flowering 3	5.469
	CRR073315	Gold flowering 1	11.426
	CRR073316	Gold flowering 2	11.852
	CRR073317	Gold flowering 3	10.083
	CRR073318	Tawny withering 1	18.862
	CRR073319	Tawny withering 2	21.056
	CRR073320	Tawny withering 3	19.092