Gene detail

Detail information of GWHGAAZE007679

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002521730.1	2.28905E-10	50S robosomal protein L11, putative [Ricinus communis]
trEMBL	tr\|B9S6W1\|B9S6W1_RICCO	9E-11	50S robosomal protein L11, putative {ECO:0000313\|EMBL:EEF40717.1}
TAIR10	AT4G35490.1	0.0000003	mitochondrial ribosomal protein L11

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	50109353	50109920	-
GWHAAZE00000002	mRNA	50109353	50109920	-
GWHAAZE00000002	exon	50109353	50109540	-
GWHAAZE00000002	exon	50109842	50109920	-
GWHAAZE00000002	CDS	50109842	50109920	-
GWHAAZE00000002	CDS	50109353	50109540	-

Transcript Sequence
>GWHTAAZE007687 ATGTTGACCGTAAAGCGTATTTATGAGATTATTGTCAGTATGTCTTTTGATTTGGAGGCTATAGGGAAATCGATTATTGGCTGCCGGTACGGATCCAGTAGTAGCTGCCCTGGTAATGCTCTTGTTTCAATGCAGACGGTGAAATATGTTTATGAGATTGTGGAGGTAAAGCAATCCGATCCTTATTGCCAGTATATCTCTTTGGAGGCTGTGAGTAAAATTGGTATGGCTTATTGCCAGTCACATTGTTCTTTTATTTATGGATGA

Network for GWHGAAZE007679

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00298.20	Ribosomal_L11	34	81	5.70E-05

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02867	RP-L11, MRPL11, rplK	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.404
	SRR3591706	second leaf	1.406
	SRR3591707	mature leaf	0.826
	SRR3591708	Shoot apex	2.439
	SRR3591709	Stem	1.677
	SRR3591710	White floral bud	1.108
	SRR3591711	White flower	2.335
	SRR3591712	Green floral bud	1.154
	SRR3591713	Yellow flower	1.621
SRP173429	SRR8316895	Juvenile bud stage	0.957
	SRR8316896	Juvenile bud stage	1.758
	SRR8316897	Juvenile bud stage	1.145
	SRR8316894	Third green stage	0.308
	SRR8316900	Third green stage	2.852
	SRR8316901	Third green stage	1.321
	SRR8316898	Complete white stage	0.021
	SRR8316899	Complete white stage	2.404
	SRR8316903	Complete white stage	0.659
	SRR8316902	Silver flowering stage	0.340
	SRR8316904	Silver flowering stage	0.661
	SRR8316905	Silver flowering stage	0.453
	SRR8316906	Gold flowering stage	0.891
	SRR8316907	Gold flowering stage	0.332
	SRR8316908	Gold flowering stage	0.388
SRP132670	SRR6706286	Control	0.444
	SRR6706287	Light intensity 50%	0.445
	SRR6706288	Light intensity 20%	0.412
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.403
	CNS0095593	Slightly white alabastrum(diploid) 2	5.056
	CNS0095594	Slightly white alabastrum(diploid) 3	2.520
	CNS0095595	Whole white alabastrum(diploid) 2	3.016
	CNS0095596	Whole white alabastrum(diploid) 3	3.710
	CNS0095597	Whole white alabastrum(diploid) 4	2.448
	CNS0095598	Silvery flower (diploied) 1	1.875
	CNS0095599	Silvery flower (diploied) 2	2.065
	CNS0095600	Silvery flower (diploied) 3	2.753
	CNS0095601	Golden flower (diploid) 1	2.071
	CNS0095602	Golden flower (diploid) 2	1.894
	CNS0095603	Golden flower (diploid) 3	1.647
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.831
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.584
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.842
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.693
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.854
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.765
	CNS0095610	Silvery flower (tetraploid) 1	1.325
	CNS0095611	Silvery flower (tetraploid) 2	0.631
	CNS0095612	Silvery flower (tetraploid) 3	0.960
	CNS0095613	Golden flower (tetraploid) 1	1.228
	CNS0095614	Golden flower (tetraploid) 2	0.988
	CNS0095615	Golden flower (tetraploid) 3	1.637
CRA001975	CRR073297	Stem 1	0.092
	CRR073298	Stem 2	0.876
	CRR073299	Stem 3	0.302
	CRR073300	Leaf 1	0.432
	CRR073301	Leaf 2	1.402
	CRR073302	Leaf 3	1.037
	CRR073303	Juvenile bud 1	0.571
	CRR073304	Juvenile bud 2	0.281
	CRR073305	Juvenile bud 3	0.560
	CRR073306	Third green 1	0.168
	CRR073307	Third green 2	0.148
	CRR073308	Third green 3	0.018
	CRR073309	Second white 1	0.289
	CRR073310	Second white 2	0.228
	CRR073311	Second white 3	0.520
	CRR073312	Silver flowering 1	0.400
	CRR073313	Silver flowering 2	0.105
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.089
	CRR073316	Gold flowering 2	0.332
	CRR073317	Gold flowering 3	0.512
	CRR073318	Tawny withering 1	2.152
	CRR073319	Tawny withering 2	2.454
	CRR073320	Tawny withering 3	1.363