Gene detail

Detail information of GWHGAAZE007573

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002264052.1	2.0315E-112	PREDICTED: proteasome subunit alpha type-7 [Vitis vinifera]
Swissprot	tr\|O24030\|PSA7_SOLLC	3E-96	Proteasome subunit alpha type-7
trEMBL	tr\|D7SNX0\|D7SNX0_VITVI	8E-113	Proteasome subunit alpha type {ECO:0000256\|RuleBase:RU000551}
TAIR10	AT5G66140.1	5E-71	proteasome alpha subunit D2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	47981554	47985880	+
GWHAAZE00000002	mRNA	47981554	47985880	+
GWHAAZE00000002	exon	47981554	47981726	+
GWHAAZE00000002	exon	47983180	47983334	+
GWHAAZE00000002	exon	47983484	47983697	+
GWHAAZE00000002	exon	47983997	47984042	+
GWHAAZE00000002	exon	47985719	47985880	+
GWHAAZE00000002	CDS	47981554	47981726	+
GWHAAZE00000002	CDS	47983180	47983334	+
GWHAAZE00000002	CDS	47983484	47983697	+
GWHAAZE00000002	CDS	47983997	47984042	+
GWHAAZE00000002	CDS	47985719	47985880	+

Transcript Sequence
>GWHTAAZE007581 ATGGCGAGATACGACAGAGCAATTACAGTATTCTCACCGGACGGTCACCTCTTCCAGGTCGAGTACGCCCTCGAAGCCGTCCGTAAGGGCAACGCCGCCGTCGGCGTCCGAGGAACCGACACTGTCGTCCTCGGTGTCGAGAAAAAGTCAACCGTCAAACTTCAAGACTCTAGGTCCGTTAGGAAGATTGTAAACCTGGATAATCACATTGCCTTGGCCTGCGCTGGTCTTAAAGCAGATGCTCGAGTCCTCATAAACAGGGCACGAATTGAATGCCAAAGCCATAGACTTACTGTTGAAGATCCGTCACTGTGGAGTATATTACACGCTAATGCCACAGGGAGGAATTCTAATTCAATGAGGGAGTTTCTAGAGAAGAACTATAAAGAAACTTCCGGCCAAGAAACGATAAAGCTTGCTATTCGCGCACTTCTCGAGGCAAGTATTTGCAGCCCGTTACATCACTTGATTTCATACTTCATATACTTACTCATTTTCACTGTCTTTTCGTATCTTGTTAGGGCTAATGTAGAACTTCCTTGTACCCTTTTTGGCGACACGTCTAGGGTCATTGGAACACCTGCAAAGGTTGTTGAGAGTGGAGGAAAGAACATAGAAGTAGCCGTGATGACAAAGGAGCATGGCCTCCGGCAACTCGATGAGGCTGAGATTGATGCCATTGTTGCCGAGATTGAAGCTGAGAAAGCTGCTGCTGAGGCTGCCAAGAAAGGCCCTCCCAGGGATACATAA

Network for GWHGAAZE007573

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF10584.10	Proteasome_A_N	4	26	4.90E-14
PF00227.27	Proteasome	27	103	7.70E-22

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02731	PSMA7	Proteasome	map03050

Gene Ontology

GO term	Ontology	Name
GO:0006511	biological_process	ubiquitin-dependent protein catabolic process
GO:0051603	biological_process	proteolysis involved in cellular protein catabolic process
GO:0019773	cellular_component	proteasome core complex, alpha-subunit complex
GO:0005839	cellular_component	proteasome core complex
GO:0004175	molecular_function	endopeptidase activity
GO:0004298	molecular_function	threonine-type endopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	43.600
	SRR3591706	second leaf	18.431
	SRR3591707	mature leaf	12.733
	SRR3591708	Shoot apex	33.767
	SRR3591709	Stem	39.275
	SRR3591710	White floral bud	26.413
	SRR3591711	White flower	95.652
	SRR3591712	Green floral bud	43.182
	SRR3591713	Yellow flower	79.768
SRP173429	SRR8316895	Juvenile bud stage	33.284
	SRR8316896	Juvenile bud stage	47.488
	SRR8316897	Juvenile bud stage	21.130
	SRR8316894	Third green stage	16.620
	SRR8316900	Third green stage	57.032
	SRR8316901	Third green stage	53.473
	SRR8316898	Complete white stage	8.915
	SRR8316899	Complete white stage	40.929
	SRR8316903	Complete white stage	14.245
	SRR8316902	Silver flowering stage	24.635
	SRR8316904	Silver flowering stage	20.528
	SRR8316905	Silver flowering stage	9.767
	SRR8316906	Gold flowering stage	84.348
	SRR8316907	Gold flowering stage	81.802
	SRR8316908	Gold flowering stage	85.543
SRP132670	SRR6706286	Control	43.795
	SRR6706287	Light intensity 50%	39.274
	SRR6706288	Light intensity 20%	46.739
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	34.825
	CNS0095593	Slightly white alabastrum(diploid) 2	33.551
	CNS0095594	Slightly white alabastrum(diploid) 3	27.548
	CNS0095595	Whole white alabastrum(diploid) 2	22.700
	CNS0095596	Whole white alabastrum(diploid) 3	23.980
	CNS0095597	Whole white alabastrum(diploid) 4	22.180
	CNS0095598	Silvery flower (diploied) 1	15.530
	CNS0095599	Silvery flower (diploied) 2	22.107
	CNS0095600	Silvery flower (diploied) 3	28.529
	CNS0095601	Golden flower (diploid) 1	20.855
	CNS0095602	Golden flower (diploid) 2	27.058
	CNS0095603	Golden flower (diploid) 3	26.858
	CNS0095604	Slightly white alabastrum(tetraploid) 1	31.977
	CNS0095605	Slightly white alabastrum(tetraploid) 2	26.885
	CNS0095606	Slightly white alabastrum(tetraploid) 3	35.450
	CNS0095607	Whole white alabastrum(tetraploid) 1	18.716
	CNS0095608	Whole white alabastrum(tetraploid) 2	13.425
	CNS0095609	Whole white alabastrum(tetraploid) 3	32.338
	CNS0095610	Silvery flower (tetraploid) 1	39.380
	CNS0095611	Silvery flower (tetraploid) 2	34.988
	CNS0095612	Silvery flower (tetraploid) 3	22.625
	CNS0095613	Golden flower (tetraploid) 1	29.023
	CNS0095614	Golden flower (tetraploid) 2	33.588
	CNS0095615	Golden flower (tetraploid) 3	34.747
CRA001975	CRR073297	Stem 1	51.725
	CRR073298	Stem 2	50.828
	CRR073299	Stem 3	77.652
	CRR073300	Leaf 1	59.384
	CRR073301	Leaf 2	59.788
	CRR073302	Leaf 3	82.065
	CRR073303	Juvenile bud 1	83.654
	CRR073304	Juvenile bud 2	70.304
	CRR073305	Juvenile bud 3	70.973
	CRR073306	Third green 1	24.193
	CRR073307	Third green 2	25.616
	CRR073308	Third green 3	21.730
	CRR073309	Second white 1	104.694
	CRR073310	Second white 2	89.350
	CRR073311	Second white 3	59.367
	CRR073312	Silver flowering 1	45.058
	CRR073313	Silver flowering 2	69.203
	CRR073314	Silver flowering 3	51.055
	CRR073315	Gold flowering 1	36.058
	CRR073316	Gold flowering 2	42.212
	CRR073317	Gold flowering 3	37.389
	CRR073318	Tawny withering 1	59.498
	CRR073319	Tawny withering 2	51.807
	CRR073320	Tawny withering 3	53.215