Gene detail

Detail information of GWHGAAZE007473

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ABG49114.1	0	peroxidase [Dimocarpus longan]
Swissprot	tr\|Q9FJZ9\|PER72_ARATH	3E-178	Peroxidase 72 (Precursor)
trEMBL	tr\|Q0ZA68\|Q0ZA68_9ROSI	0	Peroxidase {ECO:0000313\|EMBL:ABG49114.1}
TAIR10	AT5G66390.1	4E-137	Peroxidase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	45898932	45900431	+
GWHAAZE00000002	mRNA	45898932	45900431	+
GWHAAZE00000002	exon	45898932	45899156	+
GWHAAZE00000002	exon	45899265	45899456	+
GWHAAZE00000002	exon	45899645	45899810	+
GWHAAZE00000002	exon	45900019	45900431	+
GWHAAZE00000002	CDS	45898932	45899156	+
GWHAAZE00000002	CDS	45899265	45899456	+
GWHAAZE00000002	CDS	45899645	45899810	+
GWHAAZE00000002	CDS	45900019	45900431	+

Transcript Sequence
>GWHTAAZE007481 ATGGCTCATTTTATGAGTTTTGTGATTTGTATATCTCTTTTAGTTTTTGCACCACTATGTTTTTCCGTTAAAACCAACAGTGGATATCTCTATCCGCAATACTACGACCGGTCGTGCCCGGAAGCAAAAGAAATTGTCTACTCTGTGGTCGAAAAGGCTGTCGCCAAAGAAGCTCGCATGGCGGCTTCATTGATTAGACTCCATTTCCATGATTGCTTTGTCAAAGGGTGTGATGCATCACTACTTTTGGACAGCACTGGGAGCCTAATAAGTGAGAAGAGGTCGAACCCTAACCGGAATTCAGCTCGTGGGTTTGAGGTCATCGACGAGATAAAATCTGAACTGGAGAAAGCGTGTCCTAATGTTGTCTCTTGTGCTGACATCTTGGCTCTGGCTGCTAAGGACTCTACTGTATTGACTGGGGGGCCTAGCTGGGAAGTGCCTTTAGGAAGAAGGGACTCTAGAGATGCAAGTTTAAGCGGCTCTAATCAGAATATTCCTGCTCCAAATAACACATTTCAGACTATCCTAACCAAATTTAAGCTTAAAGGGCTTGACATTGTTGATCTTGTGGCTCTTTCTGGAAGTCACACAATAGGTAATGCACGATGTACCAGTTTTAGGCAGAGGCTCTACAACCAGACAGGGAACGGTCAACCAGACACCACGCTAGACCAATCATACGCGGCCCAACTACGAACGCGTTGCCCAAGATCCGGTGGCGACCAGATCCTGTTTAACTTGGACTTCGTCTCCCCAACGAAATTCGACAACAGCTATTTCAAGCTCTTATTAGCTTCCAAGGGACTATTAAGTTCGGACCAAGTTCTAGTGACCAGAAGTGAAGCATCGCTGGACTTGGTGAAGAAATACGCGGAAAATAATGAGATCTTCTTCGAGCAATTCGCTAAGTCTATGCTTAAGATGGGAAATATTTCTCCACTGACTGGTTCAAGGGGAGAGATTAGAAAGAGGTGCAGAAAGATGAATAATTAG

Network for GWHGAAZE007473

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00141.24	peroxidase	46	294	1.30E-77

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00430	E1.11.1.7	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Phenylpropanoid biosynthesis	map00940

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0006979	biological_process	response to oxidative stress
GO:0042744	biological_process	hydrogen peroxide catabolic process
GO:0004601	molecular_function	peroxidase activity
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.417
	SRR3591706	second leaf	0.213
	SRR3591707	mature leaf	0.542
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	2.825
	SRR3591710	White floral bud	0.348
	SRR3591711	White flower	0.352
	SRR3591712	Green floral bud	0.855
	SRR3591713	Yellow flower	1.291
SRP173429	SRR8316895	Juvenile bud stage	1.679
	SRR8316896	Juvenile bud stage	0.809
	SRR8316897	Juvenile bud stage	0.587
	SRR8316894	Third green stage	0.054
	SRR8316900	Third green stage	0.313
	SRR8316901	Third green stage	0.463
	SRR8316898	Complete white stage	0.064
	SRR8316899	Complete white stage	0.150
	SRR8316903	Complete white stage	0.286
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.137
	SRR8316905	Silver flowering stage	0.143
	SRR8316906	Gold flowering stage	0.508
	SRR8316907	Gold flowering stage	0.552
	SRR8316908	Gold flowering stage	0.404
SRP132670	SRR6706286	Control	0.642
	SRR6706287	Light intensity 50%	0.759
	SRR6706288	Light intensity 20%	0.640
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.210
	CNS0095593	Slightly white alabastrum(diploid) 2	0.266
	CNS0095594	Slightly white alabastrum(diploid) 3	0.307
	CNS0095595	Whole white alabastrum(diploid) 2	0.042
	CNS0095596	Whole white alabastrum(diploid) 3	0.073
	CNS0095597	Whole white alabastrum(diploid) 4	0.100
	CNS0095598	Silvery flower (diploied) 1	0.078
	CNS0095599	Silvery flower (diploied) 2	0.095
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.010
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.043
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.147
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.066
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.086
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.476
	CNS0095610	Silvery flower (tetraploid) 1	2.893
	CNS0095611	Silvery flower (tetraploid) 2	1.593
	CNS0095612	Silvery flower (tetraploid) 3	1.862
	CNS0095613	Golden flower (tetraploid) 1	0.369
	CNS0095614	Golden flower (tetraploid) 2	0.814
	CNS0095615	Golden flower (tetraploid) 3	1.260
CRA001975	CRR073297	Stem 1	0.187
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.403
	CRR073300	Leaf 1	0.451
	CRR073301	Leaf 2	0.174
	CRR073302	Leaf 3	0.240
	CRR073303	Juvenile bud 1	0.058
	CRR073304	Juvenile bud 2	0.326
	CRR073305	Juvenile bud 3	0.076
	CRR073306	Third green 1	0.060
	CRR073307	Third green 2	0.300
	CRR073308	Third green 3	0.348
	CRR073309	Second white 1	0.026
	CRR073310	Second white 2	0.282
	CRR073311	Second white 3	0.004
	CRR073312	Silver flowering 1	0.047
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	294.011
	CRR073319	Tawny withering 2	175.862
	CRR073320	Tawny withering 3	246.429