Gene detail

Detail information of GWHGAAZE007456

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004232423.1	1.3921E-48	PREDICTED: soluble inorganic pyrophosphatase [Solanum lycopersicum]
Swissprot	tr\|Q0DYB1\|IPYR_ORYSJ	1E-46	Soluble inorganic pyrophosphatase
trEMBL	tr\|A0A059ASQ6\|A0A059ASQ6_EUCGR	1E-48	Uncharacterized protein {ECO:0000313\|EMBL:KCW56731.1}
TAIR10	AT1G01050.1	1E-36	pyrophosphorylase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	45572750	45573762	+
GWHAAZE00000002	mRNA	45572750	45573762	+
GWHAAZE00000002	exon	45572750	45572882	+
GWHAAZE00000002	exon	45573496	45573577	+
GWHAAZE00000002	exon	45573720	45573762	+
GWHAAZE00000002	CDS	45572750	45572882	+
GWHAAZE00000002	CDS	45573496	45573577	+
GWHAAZE00000002	CDS	45573720	45573762	+

Transcript Sequence
>GWHTAAZE007464 ATGCTCTTACAGGGTGAAAAGGATGACAAAATTATTGCAGTGTGTGCTGATGACCCCGAATTCCGTCACTACACAGACCTCAAGGAACTTCCTCCTCACCGTCTTGCTGAAATCCGTCGCTTCTTTGAGGACTACAAAAAGAATGAGAACAAATCAGTTGCGGTTAATGACTTTCTTCCTGCTGATGACGCTATTGATGCTATCAAGTACTCCATGGATCTGTATGCATCTTACATTGTGGAAAGCTTGAGGCAGTGA

Network for GWHGAAZE007456

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00719.20	Pyrophosphatase	4	75	5.00E-16

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01507	ppa	Oxidative phosphorylation	map00190

Gene Ontology

GO term	Ontology	Name
GO:0006796	biological_process	phosphate-containing compound metabolic process
GO:0005737	cellular_component	cytoplasm
GO:0000287	molecular_function	magnesium ion binding
GO:0004427	molecular_function	inorganic diphosphatase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	67.471
	SRR3591706	second leaf	60.978
	SRR3591707	mature leaf	91.164
	SRR3591708	Shoot apex	65.463
	SRR3591709	Stem	55.308
	SRR3591710	White floral bud	64.044
	SRR3591711	White flower	64.577
	SRR3591712	Green floral bud	77.175
	SRR3591713	Yellow flower	72.882
SRP173429	SRR8316895	Juvenile bud stage	34.394
	SRR8316896	Juvenile bud stage	53.150
	SRR8316897	Juvenile bud stage	25.481
	SRR8316894	Third green stage	20.947
	SRR8316900	Third green stage	83.201
	SRR8316901	Third green stage	78.313
	SRR8316898	Complete white stage	42.771
	SRR8316899	Complete white stage	91.012
	SRR8316903	Complete white stage	47.729
	SRR8316902	Silver flowering stage	37.444
	SRR8316904	Silver flowering stage	35.812
	SRR8316905	Silver flowering stage	14.453
	SRR8316906	Gold flowering stage	52.430
	SRR8316907	Gold flowering stage	52.002
	SRR8316908	Gold flowering stage	63.302
SRP132670	SRR6706286	Control	36.501
	SRR6706287	Light intensity 50%	33.419
	SRR6706288	Light intensity 20%	38.423
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	72.435
	CNS0095593	Slightly white alabastrum(diploid) 2	82.045
	CNS0095594	Slightly white alabastrum(diploid) 3	63.161
	CNS0095595	Whole white alabastrum(diploid) 2	80.103
	CNS0095596	Whole white alabastrum(diploid) 3	88.331
	CNS0095597	Whole white alabastrum(diploid) 4	79.513
	CNS0095598	Silvery flower (diploied) 1	78.386
	CNS0095599	Silvery flower (diploied) 2	73.937
	CNS0095600	Silvery flower (diploied) 3	83.744
	CNS0095601	Golden flower (diploid) 1	63.842
	CNS0095602	Golden flower (diploid) 2	63.401
	CNS0095603	Golden flower (diploid) 3	55.437
	CNS0095604	Slightly white alabastrum(tetraploid) 1	68.332
	CNS0095605	Slightly white alabastrum(tetraploid) 2	69.827
	CNS0095606	Slightly white alabastrum(tetraploid) 3	73.036
	CNS0095607	Whole white alabastrum(tetraploid) 1	61.619
	CNS0095608	Whole white alabastrum(tetraploid) 2	76.500
	CNS0095609	Whole white alabastrum(tetraploid) 3	74.051
	CNS0095610	Silvery flower (tetraploid) 1	105.699
	CNS0095611	Silvery flower (tetraploid) 2	98.040
	CNS0095612	Silvery flower (tetraploid) 3	87.366
	CNS0095613	Golden flower (tetraploid) 1	78.877
	CNS0095614	Golden flower (tetraploid) 2	78.195
	CNS0095615	Golden flower (tetraploid) 3	43.844
CRA001975	CRR073297	Stem 1	41.872
	CRR073298	Stem 2	47.495
	CRR073299	Stem 3	44.476
	CRR073300	Leaf 1	54.072
	CRR073301	Leaf 2	60.973
	CRR073302	Leaf 3	67.512
	CRR073303	Juvenile bud 1	82.180
	CRR073304	Juvenile bud 2	73.341
	CRR073305	Juvenile bud 3	73.065
	CRR073306	Third green 1	33.760
	CRR073307	Third green 2	26.167
	CRR073308	Third green 3	28.516
	CRR073309	Second white 1	62.503
	CRR073310	Second white 2	31.998
	CRR073311	Second white 3	19.006
	CRR073312	Silver flowering 1	17.964
	CRR073313	Silver flowering 2	41.190
	CRR073314	Silver flowering 3	19.947
	CRR073315	Gold flowering 1	61.933
	CRR073316	Gold flowering 2	62.538
	CRR073317	Gold flowering 3	60.516
	CRR073318	Tawny withering 1	41.519
	CRR073319	Tawny withering 2	49.822
	CRR073320	Tawny withering 3	47.778