Gene detail

Detail information of GWHGAAZE007375

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010264632.1	6.7637E-137	PREDICTED: delta(7)-sterol-C5(6)-desaturase-like [Nelumbo nucifera]
Swissprot	tr\|Q9ZT29\|SC5D_TOBAC	1E-134	Delta(7)-sterol-C5(6)-desaturase
trEMBL	tr\|K4BBC6\|K4BBC6_SOLLC	6E-137	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc02g086180.2.1}
TAIR10	AT3G02580.1	1E-101	sterol 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	44060053	44065005	-
GWHAAZE00000002	mRNA	44060053	44065005	-
GWHAAZE00000002	exon	44064885	44065005	-
GWHAAZE00000002	exon	44062300	44062605	-
GWHAAZE00000002	exon	44060053	44060384	-
GWHAAZE00000002	CDS	44064885	44065005	-
GWHAAZE00000002	CDS	44062300	44062605	-
GWHAAZE00000002	CDS	44060053	44060384	-

Transcript Sequence
>GWHTAAZE007383 ATGGACGATTATTTGCAATTGTTCGTGGAGGAGACGTCTTTCTACAATCGGATAGTGCTGGGGGCGTTGTTGCCGGAGAAACTCTGGGGTCCAATTCCTCACTTCTTCCAAGGGTGGCTCCATGCCATCCCTTCTACAAAGGCTATGCTTTTGCAAATATATGTTGCAATGAAGGCCATGCCATGGTACTCTGCTCTTCCTTCGGTTTCGGAGTACATGATTGAAAATGGATGGACCAGATGCTTTTCAAGAATAAATGATTTTGGTTGGACTGGCTACTTTTTTAATTTGATTGTTTATCTTGTCATCGTGGAGTTTGGTATTTACTGGATGCATAGAGAGTTGCACGACATAAAACCTCTCTACAAGTATCTTCATGCAACACATCATATCTACAACAAGCAAAATACACTTTCTCCTTTTGCTGATAACTATTTACTTGATGTGTCCTTTTTCATATCAGGATTGGCATTCCACCCACTAGACGGTATACTACAAGCAGTACCGCACATAATAGCTCTATTCATCATTCCAATGCATTTCACAACACACGTAGTGCTCATATTCCTTGAAGGCGTATGGACGGCAAACATTCACGATTGCATTCACGGCAAGCTCTGGCCCATAATGGGCGCTGGATACCACACGATCCATCACACCACTTACAAACATAACTATGGCCACTACACGATATGGATGGACTGGATGTTCGGGACTCTTTACGATCCTGCTGATGATGATCATAATAAGAGGATATAA

Network for GWHGAAZE007375

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04116.14	FA_hydroxylase	98	239	6.90E-16

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00227	SC5DL, ERG3	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Steroid biosynthesis	map00100

Gene Ontology

GO term	Ontology	Name
GO:0008610	biological_process	lipid biosynthetic process
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	52.407
	SRR3591706	second leaf	31.238
	SRR3591707	mature leaf	10.300
	SRR3591708	Shoot apex	40.546
	SRR3591709	Stem	21.996
	SRR3591710	White floral bud	18.062
	SRR3591711	White flower	9.308
	SRR3591712	Green floral bud	39.976
	SRR3591713	Yellow flower	2.909
SRP173429	SRR8316895	Juvenile bud stage	23.194
	SRR8316896	Juvenile bud stage	37.425
	SRR8316897	Juvenile bud stage	20.077
	SRR8316894	Third green stage	18.233
	SRR8316900	Third green stage	52.793
	SRR8316901	Third green stage	42.732
	SRR8316898	Complete white stage	9.623
	SRR8316899	Complete white stage	60.126
	SRR8316903	Complete white stage	17.308
	SRR8316902	Silver flowering stage	4.310
	SRR8316904	Silver flowering stage	4.815
	SRR8316905	Silver flowering stage	2.375
	SRR8316906	Gold flowering stage	5.623
	SRR8316907	Gold flowering stage	3.374
	SRR8316908	Gold flowering stage	3.193
SRP132670	SRR6706286	Control	32.100
	SRR6706287	Light intensity 50%	34.698
	SRR6706288	Light intensity 20%	36.385
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	48.726
	CNS0095593	Slightly white alabastrum(diploid) 2	47.966
	CNS0095594	Slightly white alabastrum(diploid) 3	47.334
	CNS0095595	Whole white alabastrum(diploid) 2	30.021
	CNS0095596	Whole white alabastrum(diploid) 3	35.221
	CNS0095597	Whole white alabastrum(diploid) 4	31.209
	CNS0095598	Silvery flower (diploied) 1	17.218
	CNS0095599	Silvery flower (diploied) 2	16.080
	CNS0095600	Silvery flower (diploied) 3	9.499
	CNS0095601	Golden flower (diploid) 1	9.680
	CNS0095602	Golden flower (diploid) 2	10.915
	CNS0095603	Golden flower (diploid) 3	8.427
	CNS0095604	Slightly white alabastrum(tetraploid) 1	43.245
	CNS0095605	Slightly white alabastrum(tetraploid) 2	40.151
	CNS0095606	Slightly white alabastrum(tetraploid) 3	56.466
	CNS0095607	Whole white alabastrum(tetraploid) 1	30.719
	CNS0095608	Whole white alabastrum(tetraploid) 2	26.374
	CNS0095609	Whole white alabastrum(tetraploid) 3	43.331
	CNS0095610	Silvery flower (tetraploid) 1	5.442
	CNS0095611	Silvery flower (tetraploid) 2	5.999
	CNS0095612	Silvery flower (tetraploid) 3	4.900
	CNS0095613	Golden flower (tetraploid) 1	1.455
	CNS0095614	Golden flower (tetraploid) 2	6.118
	CNS0095615	Golden flower (tetraploid) 3	2.983
CRA001975	CRR073297	Stem 1	33.304
	CRR073298	Stem 2	32.430
	CRR073299	Stem 3	29.528
	CRR073300	Leaf 1	38.021
	CRR073301	Leaf 2	40.819
	CRR073302	Leaf 3	43.862
	CRR073303	Juvenile bud 1	43.265
	CRR073304	Juvenile bud 2	28.588
	CRR073305	Juvenile bud 3	40.283
	CRR073306	Third green 1	6.322
	CRR073307	Third green 2	8.157
	CRR073308	Third green 3	7.605
	CRR073309	Second white 1	2.693
	CRR073310	Second white 2	1.263
	CRR073311	Second white 3	0.832
	CRR073312	Silver flowering 1	0.160
	CRR073313	Silver flowering 2	0.065
	CRR073314	Silver flowering 3	0.409
	CRR073315	Gold flowering 1	46.130
	CRR073316	Gold flowering 2	56.738
	CRR073317	Gold flowering 3	43.231
	CRR073318	Tawny withering 1	17.234
	CRR073319	Tawny withering 2	15.313
	CRR073320	Tawny withering 3	19.784