Gene detail

Detail information of GWHGAAZE007279

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009797379.1	3.52132E-94	PREDICTED: syntaxin-132-like [Nicotiana sylvestris]
Swissprot	tr\|Q8VZU2\|SY132_ARATH	9E-85	Syntaxin-132
trEMBL	tr\|K4AVP6\|K4AVP6_SOLLC	3E-95	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc01g056810.2.1}
TAIR10	AT5G08080.3	2E-62	syntaxin of plants 132

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	41883506	41887275	+
GWHAAZE00000002	mRNA	41883506	41887275	+
GWHAAZE00000002	exon	41883506	41883520	+
GWHAAZE00000002	exon	41883611	41883671	+
GWHAAZE00000002	exon	41883781	41883806	+
GWHAAZE00000002	exon	41883921	41883998	+
GWHAAZE00000002	exon	41885286	41885366	+
GWHAAZE00000002	exon	41886365	41886430	+
GWHAAZE00000002	exon	41887102	41887275	+
GWHAAZE00000002	CDS	41883506	41883520	+
GWHAAZE00000002	CDS	41883611	41883671	+
GWHAAZE00000002	CDS	41883781	41883806	+
GWHAAZE00000002	CDS	41883921	41883998	+
GWHAAZE00000002	CDS	41885286	41885366	+
GWHAAZE00000002	CDS	41886365	41886430	+
GWHAAZE00000002	CDS	41887102	41887275	+

Transcript Sequence
>GWHTAAZE007287 ATGTCTGAATTTCAGACCCTAAGGGAAAGCATCCATCAGGAGCATCGGGAGGTAGTCGAGAGGCGTGTTTATACAGTGACGGGCAACAGAGCTGATGAAGAGACGATTGATCGTTTGATAGAAACGGGAGATAGCGAACAGATTTTCCAGAAAGCGATTCAGGAACAAGGACGAGGCCAGATAATGGACACCCTTGCGGAAATTCAAGAACGCCAGGATGCAGTTAGAGAAGTAGAGAGGAAGCTTCTGGAGTTGCAACAGATATTCATGGATATGGCGGTACTAGTGGATGCTCAAGGGGACATGCTTGATAACATAGAAACACAGGTATCAAGTGCAGTAGATCATGTGCAGTCAGGGAATACTGCCCTGCAAAAGGCAAAGAGTTTGCAAAAGAACTCAAGGAAATGGATGTGCATTGCTATCATCATCCTCCTTGTCATTGTTTTAGTTATTGTTGTTGGGGTCCTCAAGCCTTGGAAAAGTAAAGGTGGTGCTTAG

Network for GWHGAAZE007279

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00804.26	Syntaxin	1	100	3.70E-37
PF05739.20	SNARE	102	153	2.30E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08486	STX1B_2_3	SNARE interactions in vesicular transport	map04130
K08486	STX1B_2_3	Synaptic vesicle cycle	map04721

Gene Ontology

GO term	Ontology	Name
GO:0006886	biological_process	intracellular protein transport
GO:0016192	biological_process	vesicle-mediated transport
GO:0016020	cellular_component	membrane
GO:0005484	molecular_function	SNAP receptor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	71.619
	SRR3591706	second leaf	27.347
	SRR3591707	mature leaf	8.503
	SRR3591708	Shoot apex	45.630
	SRR3591709	Stem	44.816
	SRR3591710	White floral bud	26.242
	SRR3591711	White flower	20.114
	SRR3591712	Green floral bud	28.822
	SRR3591713	Yellow flower	13.627
SRP173429	SRR8316895	Juvenile bud stage	24.521
	SRR8316896	Juvenile bud stage	41.937
	SRR8316897	Juvenile bud stage	21.317
	SRR8316894	Third green stage	15.411
	SRR8316900	Third green stage	43.799
	SRR8316901	Third green stage	47.139
	SRR8316898	Complete white stage	25.699
	SRR8316899	Complete white stage	56.519
	SRR8316903	Complete white stage	32.427
	SRR8316902	Silver flowering stage	19.409
	SRR8316904	Silver flowering stage	24.222
	SRR8316905	Silver flowering stage	11.833
	SRR8316906	Gold flowering stage	36.189
	SRR8316907	Gold flowering stage	31.262
	SRR8316908	Gold flowering stage	30.286
SRP132670	SRR6706286	Control	32.044
	SRR6706287	Light intensity 50%	39.488
	SRR6706288	Light intensity 20%	40.259
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	53.446
	CNS0095593	Slightly white alabastrum(diploid) 2	74.395
	CNS0095594	Slightly white alabastrum(diploid) 3	49.709
	CNS0095595	Whole white alabastrum(diploid) 2	41.520
	CNS0095596	Whole white alabastrum(diploid) 3	41.972
	CNS0095597	Whole white alabastrum(diploid) 4	43.392
	CNS0095598	Silvery flower (diploied) 1	25.585
	CNS0095599	Silvery flower (diploied) 2	24.394
	CNS0095600	Silvery flower (diploied) 3	26.322
	CNS0095601	Golden flower (diploid) 1	24.918
	CNS0095602	Golden flower (diploid) 2	19.800
	CNS0095603	Golden flower (diploid) 3	21.259
	CNS0095604	Slightly white alabastrum(tetraploid) 1	62.969
	CNS0095605	Slightly white alabastrum(tetraploid) 2	55.626
	CNS0095606	Slightly white alabastrum(tetraploid) 3	75.932
	CNS0095607	Whole white alabastrum(tetraploid) 1	39.680
	CNS0095608	Whole white alabastrum(tetraploid) 2	32.612
	CNS0095609	Whole white alabastrum(tetraploid) 3	52.766
	CNS0095610	Silvery flower (tetraploid) 1	50.928
	CNS0095611	Silvery flower (tetraploid) 2	27.686
	CNS0095612	Silvery flower (tetraploid) 3	46.178
	CNS0095613	Golden flower (tetraploid) 1	38.880
	CNS0095614	Golden flower (tetraploid) 2	41.153
	CNS0095615	Golden flower (tetraploid) 3	18.523
CRA001975	CRR073297	Stem 1	43.993
	CRR073298	Stem 2	38.398
	CRR073299	Stem 3	36.625
	CRR073300	Leaf 1	54.207
	CRR073301	Leaf 2	57.277
	CRR073302	Leaf 3	47.696
	CRR073303	Juvenile bud 1	47.769
	CRR073304	Juvenile bud 2	57.043
	CRR073305	Juvenile bud 3	39.515
	CRR073306	Third green 1	83.805
	CRR073307	Third green 2	66.971
	CRR073308	Third green 3	67.515
	CRR073309	Second white 1	17.150
	CRR073310	Second white 2	22.803
	CRR073311	Second white 3	15.649
	CRR073312	Silver flowering 1	10.804
	CRR073313	Silver flowering 2	10.969
	CRR073314	Silver flowering 3	9.083
	CRR073315	Gold flowering 1	18.212
	CRR073316	Gold flowering 2	21.614
	CRR073317	Gold flowering 3	10.413
	CRR073318	Tawny withering 1	51.285
	CRR073319	Tawny withering 2	41.409
	CRR073320	Tawny withering 3	66.394