Gene detail

Detail information of GWHGAAZE007260

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011069985.1	1.52421E-95	PREDICTED: ABSCISIC ACID-INSENSITIVE 5-like protein 2 [Sesamum indicum]
Swissprot	tr\|Q9LES3\|AI5L2_ARATH	4E-84	ABSCISIC ACID-INSENSITIVE 5-like protein 2
trEMBL	tr\|M1S3J9\|M1S3J9_CAMSI	2E-114	BZIP transcription factor bZIP7 {ECO:0000313\|EMBL:AGG39691.1}
TAIR10	AT3G56850.1	1E-68	ABA-responsive element binding protein 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	41467255	41468268	-
GWHAAZE00000002	mRNA	41467255	41468268	-
GWHAAZE00000002	exon	41468126	41468268	-
GWHAAZE00000002	exon	41467726	41468062	-
GWHAAZE00000002	exon	41467450	41467590	-
GWHAAZE00000002	exon	41467255	41467359	-
GWHAAZE00000002	CDS	41468126	41468268	-
GWHAAZE00000002	CDS	41467726	41468062	-
GWHAAZE00000002	CDS	41467450	41467590	-
GWHAAZE00000002	CDS	41467255	41467359	-

Transcript Sequence
>GWHTAAZE007268 GGTAGAGGGCAAGAGCCAAAATCCGATGCATTATCACGGCAAGGCTCTTTGTACAATCTTACCCTTGACGAGGTTCAGAATCAATTGGGAGATTTGGGGAAACCCTTGAGCAGCATGAATCTTGATGAACTTCTCAAGAGTGTTCAGCTCCCCTCAGCCTCCTCTCTGAACCGCCAATCAAGCCTTACACTAACCCGGGACTTGAGCAAGAAGACTGTTGATGAGTTGTGGCAAGATATCAAACAGGGGAACAAGAATAGTGATCTTGATAGAAAAGCCCAAGAGAGACAACCAACTCTTGGTGAAATGACATTAGAGGACTTCCTGGTTAAGGCTGGGGTGGTTGCTGAGTCATCACCGGGGAAGAACAATGCGGGCCCTGATCTAGGGATTGATCAGATTGCATTGCCGCAAACCAATGTTCCTCAGCAACCTCATTGGATGCACTACCAGATCCCCCCGGTTCAACCGCAGCAGCAAATGGGCACGCTTTCTGATACACAGACGCCTGGGAGGAAAAGGGGTGAACCTGGAGACGTGGTTGAGAAGACTGTTGAGAGGAGGCAGAAGAGGATGATCAAGAATAGGGAATCTGCAGCTCGATCACGAGCTAGGAAACAGGCTTACACCCATGAGTTGGAGAACAAGGTTTCGCGTCTAGAAGAGGAGAATGAAAGGCTTAAGAGGCAGAAGGTAGGTTTTGTCACCTTTATCCTCTACTTTTGA

Network for GWHGAAZE007260

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00170.22	bZIP_1	187	229	8.40E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bZIP

KEGG pathway

KO	Enzyme	pathway	mapID
K14432	ABF	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	43.363
	SRR3591706	second leaf	16.590
	SRR3591707	mature leaf	19.671
	SRR3591708	Shoot apex	35.630
	SRR3591709	Stem	46.450
	SRR3591710	White floral bud	32.031
	SRR3591711	White flower	30.381
	SRR3591712	Green floral bud	36.374
	SRR3591713	Yellow flower	26.104
SRP173429	SRR8316895	Juvenile bud stage	15.256
	SRR8316896	Juvenile bud stage	22.988
	SRR8316897	Juvenile bud stage	8.717
	SRR8316894	Third green stage	11.285
	SRR8316900	Third green stage	31.057
	SRR8316901	Third green stage	29.000
	SRR8316898	Complete white stage	14.568
	SRR8316899	Complete white stage	48.176
	SRR8316903	Complete white stage	19.128
	SRR8316902	Silver flowering stage	7.609
	SRR8316904	Silver flowering stage	10.851
	SRR8316905	Silver flowering stage	5.118
	SRR8316906	Gold flowering stage	18.477
	SRR8316907	Gold flowering stage	18.598
	SRR8316908	Gold flowering stage	18.452
SRP132670	SRR6706286	Control	50.717
	SRR6706287	Light intensity 50%	51.056
	SRR6706288	Light intensity 20%	52.908
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	26.982
	CNS0095593	Slightly white alabastrum(diploid) 2	26.855
	CNS0095594	Slightly white alabastrum(diploid) 3	21.089
	CNS0095595	Whole white alabastrum(diploid) 2	24.583
	CNS0095596	Whole white alabastrum(diploid) 3	25.032
	CNS0095597	Whole white alabastrum(diploid) 4	21.688
	CNS0095598	Silvery flower (diploied) 1	26.900
	CNS0095599	Silvery flower (diploied) 2	19.295
	CNS0095600	Silvery flower (diploied) 3	29.884
	CNS0095601	Golden flower (diploid) 1	20.010
	CNS0095602	Golden flower (diploid) 2	30.691
	CNS0095603	Golden flower (diploid) 3	29.698
	CNS0095604	Slightly white alabastrum(tetraploid) 1	35.454
	CNS0095605	Slightly white alabastrum(tetraploid) 2	28.694
	CNS0095606	Slightly white alabastrum(tetraploid) 3	56.010
	CNS0095607	Whole white alabastrum(tetraploid) 1	26.240
	CNS0095608	Whole white alabastrum(tetraploid) 2	19.484
	CNS0095609	Whole white alabastrum(tetraploid) 3	39.092
	CNS0095610	Silvery flower (tetraploid) 1	35.357
	CNS0095611	Silvery flower (tetraploid) 2	30.387
	CNS0095612	Silvery flower (tetraploid) 3	21.423
	CNS0095613	Golden flower (tetraploid) 1	20.819
	CNS0095614	Golden flower (tetraploid) 2	34.891
	CNS0095615	Golden flower (tetraploid) 3	25.369
CRA001975	CRR073297	Stem 1	42.477
	CRR073298	Stem 2	43.341
	CRR073299	Stem 3	41.483
	CRR073300	Leaf 1	51.751
	CRR073301	Leaf 2	54.032
	CRR073302	Leaf 3	47.108
	CRR073303	Juvenile bud 1	46.967
	CRR073304	Juvenile bud 2	41.661
	CRR073305	Juvenile bud 3	67.518
	CRR073306	Third green 1	19.291
	CRR073307	Third green 2	16.270
	CRR073308	Third green 3	18.113
	CRR073309	Second white 1	14.041
	CRR073310	Second white 2	10.738
	CRR073311	Second white 3	10.196
	CRR073312	Silver flowering 1	10.541
	CRR073313	Silver flowering 2	8.518
	CRR073314	Silver flowering 3	5.815
	CRR073315	Gold flowering 1	22.233
	CRR073316	Gold flowering 2	23.254
	CRR073317	Gold flowering 3	24.188
	CRR073318	Tawny withering 1	45.719
	CRR073319	Tawny withering 2	35.996
	CRR073320	Tawny withering 3	49.997