Gene detail

Detail information of GWHGAAZE007224

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010036386.1	1.31776E-83	PREDICTED: transcription factor PCL1-like [Eucalyptus grandis]
Swissprot	tr\|Q9SNB4\|PCL1_ARATH	4E-45	Transcription factor LUX
trEMBL	tr\|A0A059A3P3\|A0A059A3P3_EUCGR	5E-84	Uncharacterized protein {ECO:0000313\|EMBL:KCW47935.1}
TAIR10	AT3G10760.1	3E-48	Homeodomain-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	40799259	40800807	+
GWHAAZE00000002	mRNA	40799259	40800807	+
GWHAAZE00000002	exon	40799259	40799525	+
GWHAAZE00000002	exon	40800357	40800534	+
GWHAAZE00000002	exon	40800620	40800807	+
GWHAAZE00000002	CDS	40799259	40799525	+
GWHAAZE00000002	CDS	40800357	40800534	+
GWHAAZE00000002	CDS	40800620	40800807	+

Transcript Sequence
>GWHTAAZE007232 GGACGGGGCAGGGATTTCTCCGGCCCCGCTCAGTCATCGCAGCCGAGCTCGGTGGAATTCGATTCCGGGGAGTTCGGAGGAGGCGGCACTGGGGATGAGCAGGCGAGGACGCTGAAGAGGCCGAGGCTGGTGTGGACCCCACAGCTGCACAAGAGGTTTGTGGATGCTGTGGCTCACCTTGGGATCAAGAATGCTGTGCCCAAGACCATAATGCAGCTCATGAGTGTTGATGGGTTGACCCGTGAGAATGTTGCCAGTCATTTACAGAAGTACAGGCTTTACCTGAAACGTATGCAGGGGATTTCGAGTGGTGGCGGTGGAGTCCCCGGAGGAATGGTATCCGGCGGTGATTCGGCCACTGATCGCTTGTTTGCCAGTTCTCCGGTGCCAGCACACTTCCTCCACCCTGTTCCCCAATTCAGACCACTTCTTGCCGTTAATGCCACCACAGTATCGCACATGGGCCATTTTGGGTCGCCGCCCAATGGGCAATTCGAGAATCCGTTTCTAGCAAGACAGCGTTTGGGTATGCAAGTGAATAACACAGTTCCATCTTATGTGGAGGATTTGGAATCAGCTACAGCAGCCACTGGGAGGAGAGTTCTCACTCTATTTCCAACTGGGGATGATTAG

Network for GWHGAAZE007224

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00249.32	Myb_DNA-binding	44	92	1.20E-08

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	GARP-G2-like

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.425
	SRR3591706	second leaf	1.109
	SRR3591707	mature leaf	1.275
	SRR3591708	Shoot apex	2.219
	SRR3591709	Stem	6.624
	SRR3591710	White floral bud	4.467
	SRR3591711	White flower	2.831
	SRR3591712	Green floral bud	5.688
	SRR3591713	Yellow flower	1.190
SRP173429	SRR8316895	Juvenile bud stage	2.321
	SRR8316896	Juvenile bud stage	1.828
	SRR8316897	Juvenile bud stage	0.638
	SRR8316894	Third green stage	1.011
	SRR8316900	Third green stage	2.364
	SRR8316901	Third green stage	3.652
	SRR8316898	Complete white stage	1.517
	SRR8316899	Complete white stage	3.625
	SRR8316903	Complete white stage	1.308
	SRR8316902	Silver flowering stage	1.268
	SRR8316904	Silver flowering stage	1.149
	SRR8316905	Silver flowering stage	0.326
	SRR8316906	Gold flowering stage	1.149
	SRR8316907	Gold flowering stage	0.708
	SRR8316908	Gold flowering stage	1.959
SRP132670	SRR6706286	Control	2.409
	SRR6706287	Light intensity 50%	1.374
	SRR6706288	Light intensity 20%	2.340
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.967
	CNS0095593	Slightly white alabastrum(diploid) 2	3.384
	CNS0095594	Slightly white alabastrum(diploid) 3	1.876
	CNS0095595	Whole white alabastrum(diploid) 2	2.873
	CNS0095596	Whole white alabastrum(diploid) 3	3.361
	CNS0095597	Whole white alabastrum(diploid) 4	3.870
	CNS0095598	Silvery flower (diploied) 1	4.259
	CNS0095599	Silvery flower (diploied) 2	0.654
	CNS0095600	Silvery flower (diploied) 3	3.729
	CNS0095601	Golden flower (diploid) 1	0.604
	CNS0095602	Golden flower (diploid) 2	2.422
	CNS0095603	Golden flower (diploid) 3	2.643
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.290
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.804
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.760
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.571
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.273
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.324
	CNS0095610	Silvery flower (tetraploid) 1	3.038
	CNS0095611	Silvery flower (tetraploid) 2	0.495
	CNS0095612	Silvery flower (tetraploid) 3	4.198
	CNS0095613	Golden flower (tetraploid) 1	1.031
	CNS0095614	Golden flower (tetraploid) 2	2.154
	CNS0095615	Golden flower (tetraploid) 3	0.985
CRA001975	CRR073297	Stem 1	3.060
	CRR073298	Stem 2	2.418
	CRR073299	Stem 3	4.809
	CRR073300	Leaf 1	3.150
	CRR073301	Leaf 2	4.117
	CRR073302	Leaf 3	1.518
	CRR073303	Juvenile bud 1	2.458
	CRR073304	Juvenile bud 2	0.870
	CRR073305	Juvenile bud 3	1.561
	CRR073306	Third green 1	1.082
	CRR073307	Third green 2	1.917
	CRR073308	Third green 3	1.117
	CRR073309	Second white 1	0.829
	CRR073310	Second white 2	0.142
	CRR073311	Second white 3	0.643
	CRR073312	Silver flowering 1	1.030
	CRR073313	Silver flowering 2	0.753
	CRR073314	Silver flowering 3	0.913
	CRR073315	Gold flowering 1	1.649
	CRR073316	Gold flowering 2	1.872
	CRR073317	Gold flowering 3	1.098
	CRR073318	Tawny withering 1	3.486
	CRR073319	Tawny withering 2	3.141
	CRR073320	Tawny withering 3	2.249