Gene detail

Detail information of GWHGAAZE007064

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002282897.1	5.27434E-65	PREDICTED: transcription factor bHLH48 [Vitis vinifera]
Swissprot	tr\|Q3EAI1\|BH060_ARATH	8E-47	Transcription factor bHLH60
trEMBL	tr\|D7TI19\|D7TI19_VITVI	2E-65	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI29895.3}
TAIR10	AT3G57800.2	3E-37	basic helix-loop-helix (bHLH) DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	37424974	37426274	+
GWHAAZE00000002	mRNA	37424974	37426274	+
GWHAAZE00000002	exon	37424974	37425444	+
GWHAAZE00000002	exon	37425537	37425665	+
GWHAAZE00000002	exon	37426194	37426274	+
GWHAAZE00000002	CDS	37424974	37425444	+
GWHAAZE00000002	CDS	37425537	37425665	+
GWHAAZE00000002	CDS	37426194	37426274	+

Transcript Sequence
>GWHTAAZE007072 ATGGAGGCGGCGAAAGGTACTGAGGTAAGATCCGACGAAATTGGGGTGGAATCCCTTCACTTCGGCGAAGAAATTCAGAATCTGATATCTCCACCGCCCGAAGCCGGAAGTTCCTTCACTGCTCTTCTCGAACTCCCGGCGAATCAGGCTGTAAAGCTATTACACTTGCCGGAACCAGAGGAATCTCCGCCAGAACTTGCTGGACCTTACACTTTTCCGTCCGACGTTGCCCTAATTGATCGTGTTTCAAAGTTCTCCATCTTTGCTGACTCGCCGGAGAGGAATTCAATTCCGTCGAATACGGATAAGGTGAAACAGGAACCAGTGGACATGGATTCACGCCCTAATTTGTTTGTGTCAGATGTAATGGTGAACGATAGCGATCGAAAATCGAACAAGCTGTTTGTTTCCGATGCAATGGTGAACAATAGCGATCGAAAATCGAACAAGCGAAAGGAACGACAGAAGAAGGTCAAAGAACCGGCGAAAAAGAGCAAAATCGTCGTCGATGAGAGTGCCAAAGACGGCGAGAAGCTACCGTACGTTCACGTCCGAGCGAGGAGGGGGCAAGCTACAGATAGCCATAGCTTAGCAGAAAGGGCTAGGAGAGAGAAGATCAACGCTAGGATGAAGCTACTTCAAGAACTGGTCCCAGGCTGCAACAAGGTTTGCTGGCGTTAG

Network for GWHGAAZE007064

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00010.27	HLH	194	218	9.80E-05

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bHLH

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0046983	molecular_function	protein dimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.988
	SRR3591706	second leaf	23.815
	SRR3591707	mature leaf	12.849
	SRR3591708	Shoot apex	38.105
	SRR3591709	Stem	10.015
	SRR3591710	White floral bud	26.180
	SRR3591711	White flower	19.148
	SRR3591712	Green floral bud	28.183
	SRR3591713	Yellow flower	6.689
SRP173429	SRR8316895	Juvenile bud stage	14.498
	SRR8316896	Juvenile bud stage	19.158
	SRR8316897	Juvenile bud stage	10.567
	SRR8316894	Third green stage	7.515
	SRR8316900	Third green stage	17.295
	SRR8316901	Third green stage	20.029
	SRR8316898	Complete white stage	6.780
	SRR8316899	Complete white stage	31.780
	SRR8316903	Complete white stage	13.943
	SRR8316902	Silver flowering stage	3.930
	SRR8316904	Silver flowering stage	5.701
	SRR8316905	Silver flowering stage	2.274
	SRR8316906	Gold flowering stage	9.160
	SRR8316907	Gold flowering stage	8.114
	SRR8316908	Gold flowering stage	9.893
SRP132670	SRR6706286	Control	40.862
	SRR6706287	Light intensity 50%	39.406
	SRR6706288	Light intensity 20%	39.622
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.206
	CNS0095593	Slightly white alabastrum(diploid) 2	9.559
	CNS0095594	Slightly white alabastrum(diploid) 3	9.722
	CNS0095595	Whole white alabastrum(diploid) 2	12.015
	CNS0095596	Whole white alabastrum(diploid) 3	6.836
	CNS0095597	Whole white alabastrum(diploid) 4	10.036
	CNS0095598	Silvery flower (diploied) 1	10.499
	CNS0095599	Silvery flower (diploied) 2	10.161
	CNS0095600	Silvery flower (diploied) 3	11.966
	CNS0095601	Golden flower (diploid) 1	10.870
	CNS0095602	Golden flower (diploid) 2	9.751
	CNS0095603	Golden flower (diploid) 3	9.693
	CNS0095604	Slightly white alabastrum(tetraploid) 1	11.440
	CNS0095605	Slightly white alabastrum(tetraploid) 2	8.145
	CNS0095606	Slightly white alabastrum(tetraploid) 3	27.198
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.102
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.542
	CNS0095609	Whole white alabastrum(tetraploid) 3	17.962
	CNS0095610	Silvery flower (tetraploid) 1	10.071
	CNS0095611	Silvery flower (tetraploid) 2	10.307
	CNS0095612	Silvery flower (tetraploid) 3	8.625
	CNS0095613	Golden flower (tetraploid) 1	2.779
	CNS0095614	Golden flower (tetraploid) 2	5.261
	CNS0095615	Golden flower (tetraploid) 3	2.376
CRA001975	CRR073297	Stem 1	41.657
	CRR073298	Stem 2	35.503
	CRR073299	Stem 3	38.049
	CRR073300	Leaf 1	42.603
	CRR073301	Leaf 2	41.558
	CRR073302	Leaf 3	37.405
	CRR073303	Juvenile bud 1	35.168
	CRR073304	Juvenile bud 2	28.309
	CRR073305	Juvenile bud 3	43.302
	CRR073306	Third green 1	9.431
	CRR073307	Third green 2	8.950
	CRR073308	Third green 3	11.284
	CRR073309	Second white 1	3.233
	CRR073310	Second white 2	2.413
	CRR073311	Second white 3	3.404
	CRR073312	Silver flowering 1	1.769
	CRR073313	Silver flowering 2	1.740
	CRR073314	Silver flowering 3	2.423
	CRR073315	Gold flowering 1	34.095
	CRR073316	Gold flowering 2	35.004
	CRR073317	Gold flowering 3	23.225
	CRR073318	Tawny withering 1	13.453
	CRR073319	Tawny withering 2	11.572
	CRR073320	Tawny withering 3	13.110