Gene detail

Detail information of GWHGAAZE007026

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011075101.1	3.1797E-134	PREDICTED: DNA-3-methyladenine glycosylase isoform X1 [Sesamum indicum]
Swissprot	tr\|Q39147\|3MG_ARATH	4E-120	DNA-3-methyladenine glycosylase
trEMBL	tr\|A0A067JPA1\|A0A067JPA1_JATCU	2E-129	Uncharacterized protein {ECO:0000313\|EMBL:KDP24653.1}
TAIR10	AT3G12040.1	1E-95	DNA-3-methyladenine glycosylase (MAG)

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	36510986	36515766	-
GWHAAZE00000002	mRNA	36510986	36515766	-
GWHAAZE00000002	exon	36515742	36515766	-
GWHAAZE00000002	exon	36514980	36515092	-
GWHAAZE00000002	exon	36514331	36514402	-
GWHAAZE00000002	exon	36513039	36513162	-
GWHAAZE00000002	exon	36511968	36512038	-
GWHAAZE00000002	exon	36511231	36511288	-
GWHAAZE00000002	exon	36510986	36511149	-
GWHAAZE00000002	CDS	36515742	36515766	-
GWHAAZE00000002	CDS	36514980	36515092	-
GWHAAZE00000002	CDS	36514331	36514402	-
GWHAAZE00000002	CDS	36513039	36513162	-
GWHAAZE00000002	CDS	36511968	36512038	-
GWHAAZE00000002	CDS	36511231	36511288	-
GWHAAZE00000002	CDS	36510986	36511149	-

Transcript Sequence
>GWHTAAZE007034 ATGGCGGCAGCGCTGAGGGGGAGGGAAAAATTCTCGATATTGACCCCAGATTTTTACCAAATCGACGCTCTAGATCTTGCCCCTCGCTTGCTTGGCAAGTACCTCAGGAGAGATGACGTTGTTCTTCAGATTACCGAGGTAGAAGCTTATAGGCCAAATGATTCTGCTTGTCATGGTCGATTCGGCATTACAGCAAGAACAGCCCCCGTTTTTGGACCTGGAGGACATGCATATGTATACCTTTGCTATGGTCTCCATACTATGCTGAACATTGTGGCAGATAAAGAAGGATGCGGTGCTGCGGTCTTAATACGCTCTTGCGCTCCTGTTAGTGGGTTGGAAACTGTTCAGCAGCGTCGTGGTTTGAAAACTGAGAAGCCTGTGCTTCTTACTGGGCCTGGGAAGGTTGGTCAAGCACTGGGAATTTCAACTGGATGGTCGAACCATCCCCTTTTCACCCCCGGCGGCTTAGAGCTGTTAGATGGGCCCGAACCAGAAAATATATTGGTCGGCCCACGCGTAGGCATTGAATATGCTTCCCCTGAGCATGTAAGTGCGCTATGGAGGTTTGCAATTGCTGGTACACCGTGGGTTAGTGCTCCTAAAAACACTCTAAGACCACCCTAG

Network for GWHGAAZE007026

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02245.17	Pur_DNA_glyco	17	196	1.90E-53

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03652	MPG	Base excision repair	map03410

Gene Ontology

GO term	Ontology	Name
GO:0006284	biological_process	base-excision repair
GO:0003677	molecular_function	DNA binding
GO:0003905	molecular_function	alkylbase DNA N-glycosylase activity
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.960
	SRR3591706	second leaf	4.299
	SRR3591707	mature leaf	6.522
	SRR3591708	Shoot apex	10.198
	SRR3591709	Stem	14.286
	SRR3591710	White floral bud	14.816
	SRR3591711	White flower	21.264
	SRR3591712	Green floral bud	10.885
	SRR3591713	Yellow flower	20.656
SRP173429	SRR8316895	Juvenile bud stage	5.588
	SRR8316896	Juvenile bud stage	4.837
	SRR8316897	Juvenile bud stage	2.122
	SRR8316894	Third green stage	2.285
	SRR8316900	Third green stage	5.969
	SRR8316901	Third green stage	6.178
	SRR8316898	Complete white stage	2.249
	SRR8316899	Complete white stage	11.070
	SRR8316903	Complete white stage	6.157
	SRR8316902	Silver flowering stage	4.118
	SRR8316904	Silver flowering stage	5.260
	SRR8316905	Silver flowering stage	2.536
	SRR8316906	Gold flowering stage	4.875
	SRR8316907	Gold flowering stage	6.291
	SRR8316908	Gold flowering stage	6.385
SRP132670	SRR6706286	Control	9.383
	SRR6706287	Light intensity 50%	9.127
	SRR6706288	Light intensity 20%	9.500
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.503
	CNS0095593	Slightly white alabastrum(diploid) 2	6.127
	CNS0095594	Slightly white alabastrum(diploid) 3	7.863
	CNS0095595	Whole white alabastrum(diploid) 2	6.832
	CNS0095596	Whole white alabastrum(diploid) 3	3.862
	CNS0095597	Whole white alabastrum(diploid) 4	5.523
	CNS0095598	Silvery flower (diploied) 1	5.535
	CNS0095599	Silvery flower (diploied) 2	8.675
	CNS0095600	Silvery flower (diploied) 3	9.780
	CNS0095601	Golden flower (diploid) 1	5.879
	CNS0095602	Golden flower (diploid) 2	6.441
	CNS0095603	Golden flower (diploid) 3	6.397
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.804
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.071
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.820
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.216
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.705
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.397
	CNS0095610	Silvery flower (tetraploid) 1	12.208
	CNS0095611	Silvery flower (tetraploid) 2	10.682
	CNS0095612	Silvery flower (tetraploid) 3	11.362
	CNS0095613	Golden flower (tetraploid) 1	10.761
	CNS0095614	Golden flower (tetraploid) 2	9.135
	CNS0095615	Golden flower (tetraploid) 3	10.035
CRA001975	CRR073297	Stem 1	9.899
	CRR073298	Stem 2	7.025
	CRR073299	Stem 3	9.616
	CRR073300	Leaf 1	9.402
	CRR073301	Leaf 2	7.093
	CRR073302	Leaf 3	11.668
	CRR073303	Juvenile bud 1	12.444
	CRR073304	Juvenile bud 2	10.559
	CRR073305	Juvenile bud 3	13.821
	CRR073306	Third green 1	9.290
	CRR073307	Third green 2	6.925
	CRR073308	Third green 3	6.370
	CRR073309	Second white 1	6.312
	CRR073310	Second white 2	6.887
	CRR073311	Second white 3	9.221
	CRR073312	Silver flowering 1	3.369
	CRR073313	Silver flowering 2	5.446
	CRR073314	Silver flowering 3	3.035
	CRR073315	Gold flowering 1	2.073
	CRR073316	Gold flowering 2	3.656
	CRR073317	Gold flowering 3	4.215
	CRR073318	Tawny withering 1	6.197
	CRR073319	Tawny withering 2	4.894
	CRR073320	Tawny withering 3	9.659