Gene detail

Detail information of GWHGAAZE006926

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007211904.1	5.5042E-132	hypothetical protein PRUPE_ppa010411mg [Prunus persica]
Swissprot	tr\|F4JJE5\|PSA4B_ARATH	1E-131	Putative proteasome subunit alpha type-4-B
trEMBL	tr\|M5WUT5\|M5WUT5_PRUPE	2E-132	Proteasome subunit alpha type {ECO:0000256\|RuleBase:RU000551}
TAIR10	AT4G15165.1	4E-96	N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	34281134	34281883	-
GWHAAZE00000002	mRNA	34281134	34281883	-
GWHAAZE00000002	exon	34281598	34281883	-
GWHAAZE00000002	exon	34281134	34281471	-
GWHAAZE00000002	CDS	34281598	34281883	-
GWHAAZE00000002	CDS	34281134	34281471	-

Transcript Sequence
>GWHTAAZE006934 ATGTCTCGAAGGTATGATAGCCGCACGACGATCTTCTCCCCTGAAGGTCGTCTCTACCAGGTCGAATACGCAATGGAGGCCATTGGAAATGCAGGGTCCGCCATCGGTATACTCTCCAAGGATGGCGTAGTCTTAGTCGGCGAAAAGAAAGTCACTTCCAAGCTCCTCCAAACCTCGACCTCGACTGAGAAAATGTACAAAATCGACGACCACTTAGCCTGTGCTGTCGCCGGGATAATGTCTGACGCCAACATCCTTATCAACACAGCCCGGGTCCAAGCCCAGCGTTGGTATAAGAATTACGGGTTCCAGCTTTATATGAGCGACCCAAGCGGCAACTATGGCGGTTGGAAGGCGGCAGCTATCGGAGCGAATAATCAGGCGGCACAGTCAATGCTGAAGCAGGATTATAAGGATGATATTACGCGTGAGGAGGCGGTACAGCTGGCGCTCAAGGTTCTTAGCAAGACTATGGATAGCACTAGCCTTACCTCAGATAAGCTTGAATTGGCTGAAGTTTTCGTGTCCTCGGGGAAAGTAAAGTACCAGGTTTGTTCACCTGATGCGCTGAGCAAGATGTTGGTAAAGTATGGTGTGACACAGCCTGCACCTGAGAGCTCTTAA

Network for GWHGAAZE006926

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF10584.10	Proteasome_A_N	5	27	1.30E-13
PF00227.27	Proteasome	30	102	4.80E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02728	PSMA4	Proteasome	map03050

Gene Ontology

GO term	Ontology	Name
GO:0051603	biological_process	proteolysis involved in cellular protein catabolic process
GO:0006511	biological_process	ubiquitin-dependent protein catabolic process
GO:0005839	cellular_component	proteasome core complex
GO:0019773	cellular_component	proteasome core complex, alpha-subunit complex
GO:0004298	molecular_function	threonine-type endopeptidase activity
GO:0004175	molecular_function	endopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	15.654
	SRR3591706	second leaf	15.602
	SRR3591707	mature leaf	8.011
	SRR3591708	Shoot apex	34.288
	SRR3591709	Stem	15.709
	SRR3591710	White floral bud	13.258
	SRR3591711	White flower	13.430
	SRR3591712	Green floral bud	17.081
	SRR3591713	Yellow flower	11.068
SRP173429	SRR8316895	Juvenile bud stage	9.419
	SRR8316896	Juvenile bud stage	19.310
	SRR8316897	Juvenile bud stage	9.311
	SRR8316894	Third green stage	6.409
	SRR8316900	Third green stage	12.344
	SRR8316901	Third green stage	15.795
	SRR8316898	Complete white stage	2.753
	SRR8316899	Complete white stage	11.064
	SRR8316903	Complete white stage	2.232
	SRR8316902	Silver flowering stage	3.644
	SRR8316904	Silver flowering stage	5.368
	SRR8316905	Silver flowering stage	1.696
	SRR8316906	Gold flowering stage	1.271
	SRR8316907	Gold flowering stage	0.639
	SRR8316908	Gold flowering stage	0.768
SRP132670	SRR6706286	Control	7.777
	SRR6706287	Light intensity 50%	7.932
	SRR6706288	Light intensity 20%	7.061
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.924
	CNS0095593	Slightly white alabastrum(diploid) 2	11.426
	CNS0095594	Slightly white alabastrum(diploid) 3	19.945
	CNS0095595	Whole white alabastrum(diploid) 2	9.425
	CNS0095596	Whole white alabastrum(diploid) 3	9.950
	CNS0095597	Whole white alabastrum(diploid) 4	6.025
	CNS0095598	Silvery flower (diploied) 1	3.739
	CNS0095599	Silvery flower (diploied) 2	4.178
	CNS0095600	Silvery flower (diploied) 3	2.837
	CNS0095601	Golden flower (diploid) 1	2.307
	CNS0095602	Golden flower (diploid) 2	2.498
	CNS0095603	Golden flower (diploid) 3	2.806
	CNS0095604	Slightly white alabastrum(tetraploid) 1	15.447
	CNS0095605	Slightly white alabastrum(tetraploid) 2	14.040
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.869
	CNS0095607	Whole white alabastrum(tetraploid) 1	12.910
	CNS0095608	Whole white alabastrum(tetraploid) 2	10.423
	CNS0095609	Whole white alabastrum(tetraploid) 3	13.634
	CNS0095610	Silvery flower (tetraploid) 1	5.602
	CNS0095611	Silvery flower (tetraploid) 2	2.393
	CNS0095612	Silvery flower (tetraploid) 3	1.699
	CNS0095613	Golden flower (tetraploid) 1	4.779
	CNS0095614	Golden flower (tetraploid) 2	4.939
	CNS0095615	Golden flower (tetraploid) 3	1.743
CRA001975	CRR073297	Stem 1	10.799
	CRR073298	Stem 2	8.688
	CRR073299	Stem 3	14.783
	CRR073300	Leaf 1	7.438
	CRR073301	Leaf 2	7.677
	CRR073302	Leaf 3	12.010
	CRR073303	Juvenile bud 1	5.081
	CRR073304	Juvenile bud 2	7.712
	CRR073305	Juvenile bud 3	4.239
	CRR073306	Third green 1	3.031
	CRR073307	Third green 2	3.104
	CRR073308	Third green 3	2.188
	CRR073309	Second white 1	2.605
	CRR073310	Second white 2	1.348
	CRR073311	Second white 3	1.750
	CRR073312	Silver flowering 1	2.466
	CRR073313	Silver flowering 2	2.708
	CRR073314	Silver flowering 3	1.595
	CRR073315	Gold flowering 1	6.200
	CRR073316	Gold flowering 2	6.419
	CRR073317	Gold flowering 3	9.785
	CRR073318	Tawny withering 1	7.275
	CRR073319	Tawny withering 2	5.714
	CRR073320	Tawny withering 3	4.727