Gene detail

Detail information of GWHGAAZE006853

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006657241.1	6.13124E-92	PREDICTED: tubulin beta-3 chain-like, partial [Oryza brachyantha]
Swissprot	tr\|Q40665\|TBB3_ORYSJ	3E-92	Tubulin beta-3 chain
trEMBL	tr\|S5FNN2\|S5FNN2_9ORYZ	4E-92	TUBB3 {ECO:0000313\|EMBL:AGQ43311.1} (Fragment)
TAIR10	AT1G20010.1	1E-72	tubulin beta-5 chain

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	33112534	33112956	-
GWHAAZE00000002	mRNA	33112534	33112956	-
GWHAAZE00000002	exon	33112534	33112956	-
GWHAAZE00000002	CDS	33112534	33112956	-

Transcript Sequence
>GWHTAAZE006861 ATGAGAGAAATCCTCCATATCCAAGGTGGCCAATGTGGTAACCAAATCGGTGCCAAATTCTGGGAAGTAATTTGCGACGAACACGGAATCGATCACACAGGAAAGTACAGTGGAGATTCGGATCTTCAATTAGAGAGAATCAGCGTGTATTACAATGAGGCGAGTGGCGGTCGATACGTTCCCCGCGCTGTTCTTATGGATCTGGAGCCTGGTACAATGGATTCGTTACGATCGGGACCGTTTGGGCAGATATTTAGGCCAGATAATTTTGTATTTGGGCAATCTGGGGCTGGTAATAATTGGGCTAAAGGGCATTATACTGAAGGAGCTGAGTTGATTGATTCTGTTCTTGATGTTGTTAGAAAGGAGGCCGAGAATTGTGATTGCATGCAGGGTAAGTTTTTTCTTGGAGAATTCTCTTGA

Network for GWHGAAZE006853

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00091.26	Tubulin	3	135	1.10E-36

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07375	TUBB	Phagosome	map04145
K07375	TUBB	Gap junction	map04540

Gene Ontology

GO term	Ontology	Name
GO:0007017	biological_process	microtubule-based process
GO:0005874	cellular_component	microtubule
GO:0005200	molecular_function	structural constituent of cytoskeleton
GO:0005525	molecular_function	GTP binding
GO:0003924	molecular_function	GTPase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	12.678
	SRR3591706	second leaf	4.508
	SRR3591707	mature leaf	3.074
	SRR3591708	Shoot apex	5.966
	SRR3591709	Stem	11.602
	SRR3591710	White floral bud	12.397
	SRR3591711	White flower	5.985
	SRR3591712	Green floral bud	11.610
	SRR3591713	Yellow flower	2.489
SRP173429	SRR8316895	Juvenile bud stage	6.520
	SRR8316896	Juvenile bud stage	6.963
	SRR8316897	Juvenile bud stage	4.400
	SRR8316894	Third green stage	3.294
	SRR8316900	Third green stage	13.349
	SRR8316901	Third green stage	13.281
	SRR8316898	Complete white stage	1.631
	SRR8316899	Complete white stage	4.787
	SRR8316903	Complete white stage	5.854
	SRR8316902	Silver flowering stage	0.927
	SRR8316904	Silver flowering stage	2.629
	SRR8316905	Silver flowering stage	0.937
	SRR8316906	Gold flowering stage	1.983
	SRR8316907	Gold flowering stage	1.452
	SRR8316908	Gold flowering stage	0.767
SRP132670	SRR6706286	Control	15.091
	SRR6706287	Light intensity 50%	17.412
	SRR6706288	Light intensity 20%	18.314
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.161
	CNS0095593	Slightly white alabastrum(diploid) 2	7.715
	CNS0095594	Slightly white alabastrum(diploid) 3	4.486
	CNS0095595	Whole white alabastrum(diploid) 2	8.744
	CNS0095596	Whole white alabastrum(diploid) 3	7.175
	CNS0095597	Whole white alabastrum(diploid) 4	7.745
	CNS0095598	Silvery flower (diploied) 1	3.279
	CNS0095599	Silvery flower (diploied) 2	2.298
	CNS0095600	Silvery flower (diploied) 3	3.201
	CNS0095601	Golden flower (diploid) 1	2.175
	CNS0095602	Golden flower (diploid) 2	5.759
	CNS0095603	Golden flower (diploid) 3	5.490
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.206
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.011
	CNS0095606	Slightly white alabastrum(tetraploid) 3	12.364
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.596
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.507
	CNS0095609	Whole white alabastrum(tetraploid) 3	15.297
	CNS0095610	Silvery flower (tetraploid) 1	10.491
	CNS0095611	Silvery flower (tetraploid) 2	11.997
	CNS0095612	Silvery flower (tetraploid) 3	11.025
	CNS0095613	Golden flower (tetraploid) 1	5.424
	CNS0095614	Golden flower (tetraploid) 2	9.567
	CNS0095615	Golden flower (tetraploid) 3	9.000
CRA001975	CRR073297	Stem 1	8.624
	CRR073298	Stem 2	11.347
	CRR073299	Stem 3	9.548
	CRR073300	Leaf 1	13.271
	CRR073301	Leaf 2	14.139
	CRR073302	Leaf 3	12.213
	CRR073303	Juvenile bud 1	12.019
	CRR073304	Juvenile bud 2	13.705
	CRR073305	Juvenile bud 3	11.092
	CRR073306	Third green 1	5.789
	CRR073307	Third green 2	10.289
	CRR073308	Third green 3	7.697
	CRR073309	Second white 1	2.967
	CRR073310	Second white 2	1.082
	CRR073311	Second white 3	1.474
	CRR073312	Silver flowering 1	5.518
	CRR073313	Silver flowering 2	8.621
	CRR073314	Silver flowering 3	3.496
	CRR073315	Gold flowering 1	4.709
	CRR073316	Gold flowering 2	3.830
	CRR073317	Gold flowering 3	4.416
	CRR073318	Tawny withering 1	9.413
	CRR073319	Tawny withering 2	5.402
	CRR073320	Tawny withering 3	11.181