Gene detail

Detail information of GWHGAAZE006690

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006386827.1	7.0022E-102	hypothetical protein POPTR_0002s22670g [Populus trichocarpa]
Swissprot	tr\|Q05609\|CTR1_ARATH	6E-56	Serine/threonine-protein kinase CTR1
trEMBL	tr\|U5GR58\|U5GR58_POPTR	3E-102	Uncharacterized protein {ECO:0000313\|EMBL:ERP64624.1}
TAIR10	AT2G31010.2	3E-77	Protein kinase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	30206440	30207784	-
GWHAAZE00000002	mRNA	30206440	30207784	-
GWHAAZE00000002	exon	30206440	30206755	-
GWHAAZE00000002	exon	30207080	30207236	-
GWHAAZE00000002	exon	30207766	30207784	-
GWHAAZE00000002	CDS	30207766	30207784	-
GWHAAZE00000002	CDS	30207080	30207236	-
GWHAAZE00000002	CDS	30206440	30206755	-

Transcript Sequence
>GWHTAAZE006698 CGTCTTCGACATCCAAATGTTATTTTATTCCTTGGTGCTTGCACCAGACCTCCTCGCTTGTCCATGGTCACTGAATTTATGGAAATGGGATCATTATATTATCTGATTCACATGAGCGGGCAGAAGAAGAAAATCAGTTGGCGAAGGAGACTAAAAATGCTATGTGACATATGCAGGGGCCTTATGTGTATCCATCGGATGAAAATAGCACATCGGGATTTGAAAAGTGCAAATTGCCTAGTGAATAAGCATTTGACAGTCAAGATTTGTGATTTCGGGCTCTCACGGGTACTAACAAGCGGACCCATGAGAGATTCTTCTTCTGCAGGAACTCCAGAGTGGATGGCTCCGGAACTCATTCGAAATGAACCCTTCACAGAGAAATGCGATATTTTCAGCCTTGGTGTCATAATATGGGAGCTATGCACTCTTAATAGACCATGGGAAGGTGTACCTTCAATCCAAGTAAGTTTGGTATCAGTTCCCTTATAA

Network for GWHGAAZE006690

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	1	150	3.90E-41

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	TKL_CTR1-DRK-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	10.475
	SRR3591706	second leaf	11.875
	SRR3591707	mature leaf	17.639
	SRR3591708	Shoot apex	9.976
	SRR3591709	Stem	10.530
	SRR3591710	White floral bud	19.108
	SRR3591711	White flower	13.851
	SRR3591712	Green floral bud	19.475
	SRR3591713	Yellow flower	14.477
SRP173429	SRR8316895	Juvenile bud stage	6.163
	SRR8316896	Juvenile bud stage	14.277
	SRR8316897	Juvenile bud stage	7.295
	SRR8316894	Third green stage	6.369
	SRR8316900	Third green stage	19.618
	SRR8316901	Third green stage	15.453
	SRR8316898	Complete white stage	6.906
	SRR8316899	Complete white stage	20.803
	SRR8316903	Complete white stage	11.756
	SRR8316902	Silver flowering stage	6.382
	SRR8316904	Silver flowering stage	9.968
	SRR8316905	Silver flowering stage	4.500
	SRR8316906	Gold flowering stage	16.543
	SRR8316907	Gold flowering stage	12.682
	SRR8316908	Gold flowering stage	14.292
SRP132670	SRR6706286	Control	10.846
	SRR6706287	Light intensity 50%	8.545
	SRR6706288	Light intensity 20%	11.685
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	22.046
	CNS0095593	Slightly white alabastrum(diploid) 2	21.540
	CNS0095594	Slightly white alabastrum(diploid) 3	28.334
	CNS0095595	Whole white alabastrum(diploid) 2	23.369
	CNS0095596	Whole white alabastrum(diploid) 3	26.309
	CNS0095597	Whole white alabastrum(diploid) 4	23.901
	CNS0095598	Silvery flower (diploied) 1	12.966
	CNS0095599	Silvery flower (diploied) 2	10.926
	CNS0095600	Silvery flower (diploied) 3	13.579
	CNS0095601	Golden flower (diploid) 1	11.596
	CNS0095602	Golden flower (diploid) 2	12.704
	CNS0095603	Golden flower (diploid) 3	12.831
	CNS0095604	Slightly white alabastrum(tetraploid) 1	23.829
	CNS0095605	Slightly white alabastrum(tetraploid) 2	30.451
	CNS0095606	Slightly white alabastrum(tetraploid) 3	23.834
	CNS0095607	Whole white alabastrum(tetraploid) 1	20.260
	CNS0095608	Whole white alabastrum(tetraploid) 2	18.816
	CNS0095609	Whole white alabastrum(tetraploid) 3	19.151
	CNS0095610	Silvery flower (tetraploid) 1	21.025
	CNS0095611	Silvery flower (tetraploid) 2	15.179
	CNS0095612	Silvery flower (tetraploid) 3	16.230
	CNS0095613	Golden flower (tetraploid) 1	19.240
	CNS0095614	Golden flower (tetraploid) 2	19.497
	CNS0095615	Golden flower (tetraploid) 3	16.733
CRA001975	CRR073297	Stem 1	12.445
	CRR073298	Stem 2	9.916
	CRR073299	Stem 3	5.991
	CRR073300	Leaf 1	12.200
	CRR073301	Leaf 2	8.871
	CRR073302	Leaf 3	5.944
	CRR073303	Juvenile bud 1	10.879
	CRR073304	Juvenile bud 2	8.401
	CRR073305	Juvenile bud 3	7.215
	CRR073306	Third green 1	2.150
	CRR073307	Third green 2	3.278
	CRR073308	Third green 3	3.139
	CRR073309	Second white 1	1.467
	CRR073310	Second white 2	3.498
	CRR073311	Second white 3	2.496
	CRR073312	Silver flowering 1	1.071
	CRR073313	Silver flowering 2	1.218
	CRR073314	Silver flowering 3	0.722
	CRR073315	Gold flowering 1	9.191
	CRR073316	Gold flowering 2	13.190
	CRR073317	Gold flowering 3	2.929
	CRR073318	Tawny withering 1	6.667
	CRR073319	Tawny withering 2	9.728
	CRR073320	Tawny withering 3	3.435