Gene detail

Detail information of GWHGAAZE006558

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO45599.1	3.71004E-76	hypothetical protein CISIN_1g040952mg [Citrus sinensis]
Swissprot	tr\|O64793\|Y1675_ARATH	7E-57	G-type lectin S-receptor-like serine/threonine-protein kinase At1g67520 (Precursor)
trEMBL	tr\|A0A067DRG4\|A0A067DRG4_CITSI	1E-76	Uncharacterized protein {ECO:0000313\|EMBL:KDO45599.1}
TAIR10	AT3G16030.1	2E-49	lectin protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	27708508	27709800	-
GWHAAZE00000002	mRNA	27708508	27709800	-
GWHAAZE00000002	exon	27708508	27708769	-
GWHAAZE00000002	exon	27709082	27709374	-
GWHAAZE00000002	exon	27709711	27709800	-
GWHAAZE00000002	CDS	27709711	27709800	-
GWHAAZE00000002	CDS	27709082	27709374	-
GWHAAZE00000002	CDS	27708508	27708769	-

Transcript Sequence
>GWHTAAZE006566 ATGTTCAGCTTTTCAAGCATATCTACTGCCACTAACAAATTCTCAGCTGCAAATAAGCTTGGAGAGGGTGGTTTCGGACCTGTATACAAGATTCTATATTTGCATACTAACTTGTGTAGTATCTGCTGTGTAAACTTCAATGCAGATCCTAATAAACGAGAGCTACTGAATTGGACTAGGCGTGTTCGAATAATTGAAGGTATTGCTCAAGGACTTCTTTATCTTCATGAGTACTCCAGATTGCGAATAGTACACAGAGATCTCAAGGCTAGTAACATTCTATTGGATGATGACATGAACCCTAAGATATCTGATTTTGGCATGGCGAGGATTTTTGGAGGAAATGAATTGCAAGCAAATACAAATCGTATTGTTGGGACATACTCTTACTTTTACGCAACAAAATCCAATTTGATTACACAAATTAGTTTCATTTTTCAGGCATGGAAGTTATGGGAAAACGAGAGGGCGGTTGAGCTGATTGATCCAATTCTACAAATCCCTTCTTCCTTGTCTATGCCACTACGCTACATTCTTGTTGGTCTCTTGTGTGTTCAAGAAAGTCCAGATGATAGGCCCACCATTGCTGAGGTATTGGGTATGCTTAGCAGTGAAAACGCACCAGCGCTAGCTTCTCCCAAGTGA

Network for GWHGAAZE006558

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	62	130	2.70E-15

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_DLSV

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.193
	SRR3591707	mature leaf	1.578
	SRR3591708	Shoot apex	0.020
	SRR3591709	Stem	0.630
	SRR3591710	White floral bud	0.211
	SRR3591711	White flower	0.355
	SRR3591712	Green floral bud	0.432
	SRR3591713	Yellow flower	0.758
SRP173429	SRR8316895	Juvenile bud stage	0.173
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.079
	SRR8316894	Third green stage	0.054
	SRR8316900	Third green stage	0.081
	SRR8316901	Third green stage	0.023
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.295
	SRR8316903	Complete white stage	0.122
	SRR8316902	Silver flowering stage	0.051
	SRR8316904	Silver flowering stage	0.070
	SRR8316905	Silver flowering stage	0.037
	SRR8316906	Gold flowering stage	0.315
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.793
SRP132670	SRR6706286	Control	0.087
	SRR6706287	Light intensity 50%	0.127
	SRR6706288	Light intensity 20%	0.103
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.457
	CNS0095593	Slightly white alabastrum(diploid) 2	0.431
	CNS0095594	Slightly white alabastrum(diploid) 3	0.337
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.015
	CNS0095597	Whole white alabastrum(diploid) 4	0.284
	CNS0095598	Silvery flower (diploied) 1	0.399
	CNS0095599	Silvery flower (diploied) 2	0.186
	CNS0095600	Silvery flower (diploied) 3	0.025
	CNS0095601	Golden flower (diploid) 1	0.560
	CNS0095602	Golden flower (diploid) 2	0.446
	CNS0095603	Golden flower (diploid) 3	0.368
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.226
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.046
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.234
	CNS0095613	Golden flower (tetraploid) 1	0.380
	CNS0095614	Golden flower (tetraploid) 2	0.303
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.079
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.004
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.001
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.077
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	1.277
	CRR073319	Tawny withering 2	2.855
	CRR073320	Tawny withering 3	0.271