Gene detail

Detail information of GWHGAAZE006441

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CAI05932.1	3.30362E-80	leafy cotyledon 1-like protein [Helianthus annuus]
Swissprot	tr\|Q84W66\|NFYB6_ARATH	4E-59	Nuclear transcription factor Y subunit B-6
trEMBL	tr\|Q5TIQ8\|Q5TIQ8_HELAN	1E-80	Leafy cotyledon 1-like protein {ECO:0000313\|EMBL:CAI05932.1}
TAIR10	AT5G47670.2	8E-46	nuclear factor Y, subunit B6

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	25669847	25670335	-
GWHAAZE00000002	mRNA	25669847	25670335	-
GWHAAZE00000002	exon	25669847	25670335	-
GWHAAZE00000002	CDS	25669847	25670335	-

Transcript Sequence
>GWHTAAZE006449 ATGCCCATAGCCAACGTGATCCGAATCATGCGAAGAATCCTCCCCCCTCACGCCAAAATCTCCGATGATGCCAAAGAAACCATCCAAGAATGCGTGTCTGAGTTCATTAGCTTTGTCACTGGTGAAGCCAACGAACGGTGCCAGCGCGAGCAGCGCAAGACCATCACTGCCGAGGACGTCCTTTGGGCAATGAGTAAGCTCGGGTTCGATGACTACATTGAACCCCTCACAATGTACCTGCACCGTTACCGAGAGTTTGATGGGGGTGAACGTGGTGGCTCGGTGAGGAGCGAGCAGTTGGTTAAGAGGACTGTTGATCACCCCGGTGGTGCATTGGGCATTGCCGGTTACGCACCGGCTTTTCACATGGGGCATCACCATGGGTTCTTTGGGGCAGCCGGGAGTTTGGGTAGCCTGTATAGGGATGCGGAGGGAGCTGGCTCGTCCGGGGTGGCTAGCCTTGAGCCTTATGGGAGGTGCAAAGAGTAA

Network for GWHGAAZE006441

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00808.24	CBFD_NFYB_HMF	1	64	8.20E-26

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NF-YB

KEGG pathway

KO	Enzyme	pathway	mapID
K08065	NFYB, HAP3	Antigen processing and presentation	map04612

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0005634	cellular_component	nucleus
GO:0046982	molecular_function	protein heterodimerization activity
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.270
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.481
	SRR3591708	Shoot apex	0.535
	SRR3591709	Stem	0.437
	SRR3591710	White floral bud	4.050
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	17.433
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.553
	SRR8316896	Juvenile bud stage	0.319
	SRR8316897	Juvenile bud stage	0.615
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.402
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.283
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.161
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.053
	SRR6706287	Light intensity 50%	0.137
	SRR6706288	Light intensity 20%	0.416
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.706
	CNS0095594	Slightly white alabastrum(diploid) 3	0.367
	CNS0095595	Whole white alabastrum(diploid) 2	0.023
	CNS0095596	Whole white alabastrum(diploid) 3	0.615
	CNS0095597	Whole white alabastrum(diploid) 4	0.828
	CNS0095598	Silvery flower (diploied) 1	0.207
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.336
	CNS0095601	Golden flower (diploid) 1	0.060
	CNS0095602	Golden flower (diploid) 2	0.161
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.633
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.019
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.263
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.768
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.406
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.116
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.126
	CNS0095612	Silvery flower (tetraploid) 3	0.236
	CNS0095613	Golden flower (tetraploid) 1	0.241
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.003
CRA001975	CRR073297	Stem 1	0.466
	CRR073298	Stem 2	0.826
	CRR073299	Stem 3	0.259
	CRR073300	Leaf 1	0.479
	CRR073301	Leaf 2	0.623
	CRR073302	Leaf 3	0.333
	CRR073303	Juvenile bud 1	0.711
	CRR073304	Juvenile bud 2	0.139
	CRR073305	Juvenile bud 3	0.609
	CRR073306	Third green 1	0.193
	CRR073307	Third green 2	0.870
	CRR073308	Third green 3	0.155
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.287
	CRR073319	Tawny withering 2	1.044
	CRR073320	Tawny withering 3	1.404