Gene detail

Detail information of GWHGAAZE006321

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007158256.1	2.26546E-64	hypothetical protein PHAVU_002G137300g [Phaseolus vulgaris]
Swissprot	tr\|Q9C616\|KAN2_ARATH	6E-46	Probable transcription factor KAN2
trEMBL	tr\|K7K188\|K7K188_SOYBN	5E-65	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA01G01875.1}
TAIR10	AT1G32240.1	1E-38	Homeodomain-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	23203486	23205425	-
GWHAAZE00000002	mRNA	23203486	23205425	-
GWHAAZE00000002	exon	23203486	23203536	-
GWHAAZE00000002	exon	23204749	23204825	-
GWHAAZE00000002	exon	23204936	23205425	-
GWHAAZE00000002	CDS	23204936	23205425	-
GWHAAZE00000002	CDS	23204749	23204825	-
GWHAAZE00000002	CDS	23203486	23203536	-

Transcript Sequence
>GWHTAAZE006329 ATGGATTTGGGTTTTTGGAAAAGAGCTTTAGCTAATTCATCTAATTCCCCAAACTTGAATAATCCCCGCAGTATTATCGACCCAAATAATCCTCACCAAAATCTGCACCCATTTTTCCAACCTGCATATTATCAAGAAACTAGTAGTAGTAGTGGTAGTAGTGGACTTATTAACAGCCAACAAGATGAACTTGGATTTTTGAAGCCTATAAGGGGAGTGCCAATTTACCAAAACTACCCTCCTCATCCTTCACCATTATCTTTCCCATTTGCTCAACAGCAACACCATCCTAATTCTTCTTCGGATAATTCTTCAATTATTAATCCTAGTACTATTGCTAGTGCTCAAATGTCTTCCCGGGGTTTGATCCGTCCGAGATTTCTGTCGAGGTTTATGGGGAAACGGAGCGTGAGGGCGCCCCGGATGAGGTGGACTACTACGCTTCACGCTCGGTTTGTTCATGCTGTTGAGCTCTTGGGTGGCCATGAAAGAGCTACACCAAAGTCTGTTCTTGAGCTCATGGATGTGAAAGATCTCACCTTGGCACATGTTAAATCCCATTTACAGATGTATCGCACTGTGAAGACAACTGATAGAGCTGCAGCTTCTTCAGGTTGA

Network for GWHGAAZE006321

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00249.32	Myb_DNA-binding	141	192	6.70E-06

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	GARP-G2-like

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	10.795
	SRR3591706	second leaf	7.946
	SRR3591707	mature leaf	8.630
	SRR3591708	Shoot apex	12.896
	SRR3591709	Stem	14.862
	SRR3591710	White floral bud	8.730
	SRR3591711	White flower	13.034
	SRR3591712	Green floral bud	5.865
	SRR3591713	Yellow flower	11.589
SRP173429	SRR8316895	Juvenile bud stage	4.613
	SRR8316896	Juvenile bud stage	5.729
	SRR8316897	Juvenile bud stage	2.680
	SRR8316894	Third green stage	2.572
	SRR8316900	Third green stage	5.070
	SRR8316901	Third green stage	4.751
	SRR8316898	Complete white stage	1.183
	SRR8316899	Complete white stage	6.864
	SRR8316903	Complete white stage	2.992
	SRR8316902	Silver flowering stage	2.324
	SRR8316904	Silver flowering stage	2.097
	SRR8316905	Silver flowering stage	1.030
	SRR8316906	Gold flowering stage	7.310
	SRR8316907	Gold flowering stage	5.686
	SRR8316908	Gold flowering stage	6.309
SRP132670	SRR6706286	Control	2.858
	SRR6706287	Light intensity 50%	3.143
	SRR6706288	Light intensity 20%	2.862
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.945
	CNS0095593	Slightly white alabastrum(diploid) 2	7.373
	CNS0095594	Slightly white alabastrum(diploid) 3	5.403
	CNS0095595	Whole white alabastrum(diploid) 2	5.611
	CNS0095596	Whole white alabastrum(diploid) 3	2.012
	CNS0095597	Whole white alabastrum(diploid) 4	3.619
	CNS0095598	Silvery flower (diploied) 1	20.744
	CNS0095599	Silvery flower (diploied) 2	12.852
	CNS0095600	Silvery flower (diploied) 3	6.995
	CNS0095601	Golden flower (diploid) 1	15.183
	CNS0095602	Golden flower (diploid) 2	8.454
	CNS0095603	Golden flower (diploid) 3	7.616
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.766
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.003
	CNS0095606	Slightly white alabastrum(tetraploid) 3	11.312
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.406
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.785
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.589
	CNS0095610	Silvery flower (tetraploid) 1	8.597
	CNS0095611	Silvery flower (tetraploid) 2	7.104
	CNS0095612	Silvery flower (tetraploid) 3	4.092
	CNS0095613	Golden flower (tetraploid) 1	6.616
	CNS0095614	Golden flower (tetraploid) 2	7.317
	CNS0095615	Golden flower (tetraploid) 3	3.697
CRA001975	CRR073297	Stem 1	7.633
	CRR073298	Stem 2	4.778
	CRR073299	Stem 3	4.125
	CRR073300	Leaf 1	5.250
	CRR073301	Leaf 2	5.917
	CRR073302	Leaf 3	3.374
	CRR073303	Juvenile bud 1	2.699
	CRR073304	Juvenile bud 2	1.672
	CRR073305	Juvenile bud 3	4.093
	CRR073306	Third green 1	2.007
	CRR073307	Third green 2	1.003
	CRR073308	Third green 3	1.336
	CRR073309	Second white 1	1.898
	CRR073310	Second white 2	4.562
	CRR073311	Second white 3	5.255
	CRR073312	Silver flowering 1	1.633
	CRR073313	Silver flowering 2	2.905
	CRR073314	Silver flowering 3	3.143
	CRR073315	Gold flowering 1	2.977
	CRR073316	Gold flowering 2	3.122
	CRR073317	Gold flowering 3	2.390
	CRR073318	Tawny withering 1	13.165
	CRR073319	Tawny withering 2	8.354
	CRR073320	Tawny withering 3	11.936