Gene detail

Detail information of GWHGAAZE006282

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004245805.1	1.86211E-52	PREDICTED: ethylene-responsive transcription factor 5-like [Solanum lycopersicum]
Swissprot	tr\|Q40478\|ERF5_TOBAC	7E-53	Ethylene-responsive transcription factor 5
trEMBL	tr\|K4CNH8\|K4CNH8_SOLLC	7E-53	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc08g078190.1.1}
TAIR10	AT5G47230.1	9E-37	ethylene responsive element binding factor 5

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	22554745	22555284	-
GWHAAZE00000002	mRNA	22554745	22555284	-
GWHAAZE00000002	exon	22554745	22555284	-
GWHAAZE00000002	CDS	22554745	22555284	-

Transcript Sequence
>GWHTAAZE006290 ATGAATCTCGATTTAGCTCCCGTTAGGAAATTAGATTCTTCCGTACAAAAATGTAACAAAGATGAGAAAAGGCATTATAGAGGGGTCCGACAGAGGCCATGGGGCAAGTATGCGGCGGAGATCCGAGATCCGAACCGCCGCGGGTCTAGGGTTTGGTTAGGTACATTCGACACCGCCATTGAGGCAGCTAGGGCTTATGACAAGGCCGCGTTTCAAATGCGCGGAAGCAAAGCGATCGTCAACTTTCCTCTAGAGGTTGCGAATTTGAGTGACAAAAACACCGCCGTGGACGGCTGCCGGAAAAGAGGAAGGGGAGAGGGAGATGAAATTCTTGAGCAGAAGGCGGTGAAGAAGGAGAGGTTGCTGCTATCGGACCAATCGGTAAATGATCAGATGGCTTGTCCGGTTACGCCGTCTGATTGGTCGGCGGTTTGTGATGAGAATGTGGAAGAGTTGTTGAGCTTCCTTCCGTTATCGCCGTTATCTCCCCACAGGGCAATGGGATATTCAATTCTCAGGTTATGGTGGTGTGAGAATTGA

Network for GWHGAAZE006282

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	25	75	2.30E-16

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.093
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.810
	SRR3591709	Stem	0.192
	SRR3591710	White floral bud	1.399
	SRR3591711	White flower	0.761
	SRR3591712	Green floral bud	1.713
	SRR3591713	Yellow flower	0.461
SRP173429	SRR8316895	Juvenile bud stage	2.381
	SRR8316896	Juvenile bud stage	1.474
	SRR8316897	Juvenile bud stage	0.704
	SRR8316894	Third green stage	1.996
	SRR8316900	Third green stage	1.470
	SRR8316901	Third green stage	1.777
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	1.494
	SRR8316903	Complete white stage	0.125
	SRR8316902	Silver flowering stage	0.533
	SRR8316904	Silver flowering stage	1.114
	SRR8316905	Silver flowering stage	0.125
	SRR8316906	Gold flowering stage	2.285
	SRR8316907	Gold flowering stage	0.889
	SRR8316908	Gold flowering stage	2.833
SRP132670	SRR6706286	Control	1.991
	SRR6706287	Light intensity 50%	1.301
	SRR6706288	Light intensity 20%	1.149
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.988
	CNS0095593	Slightly white alabastrum(diploid) 2	2.349
	CNS0095594	Slightly white alabastrum(diploid) 3	1.950
	CNS0095595	Whole white alabastrum(diploid) 2	1.675
	CNS0095596	Whole white alabastrum(diploid) 3	2.604
	CNS0095597	Whole white alabastrum(diploid) 4	2.836
	CNS0095598	Silvery flower (diploied) 1	1.036
	CNS0095599	Silvery flower (diploied) 2	0.728
	CNS0095600	Silvery flower (diploied) 3	0.392
	CNS0095601	Golden flower (diploid) 1	2.782
	CNS0095602	Golden flower (diploid) 2	1.742
	CNS0095603	Golden flower (diploid) 3	0.460
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.664
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.715
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.531
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.568
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.374
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.164
	CNS0095610	Silvery flower (tetraploid) 1	0.076
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.249
	CNS0095613	Golden flower (tetraploid) 1	0.685
	CNS0095614	Golden flower (tetraploid) 2	0.117
	CNS0095615	Golden flower (tetraploid) 3	0.313
CRA001975	CRR073297	Stem 1	1.509
	CRR073298	Stem 2	1.992
	CRR073299	Stem 3	2.915
	CRR073300	Leaf 1	1.899
	CRR073301	Leaf 2	3.039
	CRR073302	Leaf 3	2.355
	CRR073303	Juvenile bud 1	3.908
	CRR073304	Juvenile bud 2	1.523
	CRR073305	Juvenile bud 3	5.403
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.528
	CRR073312	Silver flowering 1	0.447
	CRR073313	Silver flowering 2	0.556
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.433
	CRR073316	Gold flowering 2	0.885
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	1.118
	CRR073319	Tawny withering 2	0.111
	CRR073320	Tawny withering 3	0.000