Gene detail

Detail information of GWHGAAZE006215

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002268529.3	1.38513E-88	PREDICTED: adenine phosphoribosyltransferase 3 [Vitis vinifera]
Swissprot	tr\|Q9SUW2\|APT3_ARATH	1E-76	Adenine phosphoribosyltransferase 3
trEMBL	tr\|A0A059CHR4\|A0A059CHR4_EUCGR	3E-87	Uncharacterized protein {ECO:0000313\|EMBL:KCW77736.1}
TAIR10	AT4G22570.1	7E-61	adenine phosphoribosyl transferase 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	21276043	21281744	+
GWHAAZE00000002	mRNA	21276043	21281744	+
GWHAAZE00000002	exon	21276043	21276124	+
GWHAAZE00000002	exon	21276252	21276362	+
GWHAAZE00000002	exon	21280035	21280127	+
GWHAAZE00000002	exon	21281527	21281744	+
GWHAAZE00000002	CDS	21276043	21276124	+
GWHAAZE00000002	CDS	21276252	21276362	+
GWHAAZE00000002	CDS	21280035	21280127	+
GWHAAZE00000002	CDS	21281527	21281744	+

Transcript Sequence
>GWHTAAZE006223 ATGTCAGCTTGCCGTGACGATGATCTTCGTATTCAAGTCATTAAATCAAAAATCCGTGTTGTCCCTAACTTCCCTAAACCAGGAATTATGTTCCAAGACATCACTACTCTGTTGCTCGATCCAAAGGCATTTAAAGACACCGTTGATTCTTTCGTCGAACGATACAAAGGGAAAAACATTTCAGTGGTTGCTGGGATAGAGGCTCGGGGTTTTATATTTGGCCCTCCCATTGCATTGGCAATAGGTGCCAAATTTGTCCCCTTGAGAAAACCAAGGAAGTTGCCTGGTGAAGTTATATCTGAAGAGTATGTTTTAGAATATGGAAGAGATTGTCTTCAGATGCATACTGGAGCAGTTGAACCAGGTGAACGAGCTTTGGTGGTTGACGATCTTATTGCTACCGGAGGCACCCTTGGTGCCGCCATAAATTTACTTGGTACTGTTTTTCTCTCTCTTTGTTACATGTTAATGAGTTTATGCTTGTGGAGCTTTTATTTTATTTGA

Network for GWHGAAZE006215

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0023	GO:0003999 adenine phosphoribosyltransferase activity GOslim:molecular_function GO:0006168 adenine salvage GOslim:biological_process GO:0009116 nucleoside metabolic process GOslim:biological_process map00230 Purine metabolism GO:0022857 transmembrane transporter activity GOslim:molecular_function

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00156.28	Pribosyltran	52	148	3.80E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00759	APRT, apt	Metabolic pathways	map01100
K00759	APRT, apt	Purine metabolism	map00230

Gene Ontology

GO term	Ontology	Name
GO:0009116	biological_process	nucleoside metabolic process
GO:0006168	biological_process	adenine salvage
GO:0005737	cellular_component	cytoplasm
GO:0003999	molecular_function	adenine phosphoribosyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	51.655
	SRR3591706	second leaf	12.559
	SRR3591707	mature leaf	16.609
	SRR3591708	Shoot apex	18.065
	SRR3591709	Stem	71.605
	SRR3591710	White floral bud	57.765
	SRR3591711	White flower	8.331
	SRR3591712	Green floral bud	139.860
	SRR3591713	Yellow flower	22.252
SRP173429	SRR8316895	Juvenile bud stage	33.406
	SRR8316896	Juvenile bud stage	88.308
	SRR8316897	Juvenile bud stage	44.905
	SRR8316894	Third green stage	43.227
	SRR8316900	Third green stage	116.322
	SRR8316901	Third green stage	94.654
	SRR8316898	Complete white stage	1.607
	SRR8316899	Complete white stage	5.054
	SRR8316903	Complete white stage	3.300
	SRR8316902	Silver flowering stage	3.841
	SRR8316904	Silver flowering stage	3.706
	SRR8316905	Silver flowering stage	2.949
	SRR8316906	Gold flowering stage	8.904
	SRR8316907	Gold flowering stage	7.119
	SRR8316908	Gold flowering stage	5.496
SRP132670	SRR6706286	Control	98.578
	SRR6706287	Light intensity 50%	99.868
	SRR6706288	Light intensity 20%	92.679
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	29.123
	CNS0095593	Slightly white alabastrum(diploid) 2	18.218
	CNS0095594	Slightly white alabastrum(diploid) 3	62.026
	CNS0095595	Whole white alabastrum(diploid) 2	28.811
	CNS0095596	Whole white alabastrum(diploid) 3	29.650
	CNS0095597	Whole white alabastrum(diploid) 4	36.175
	CNS0095598	Silvery flower (diploied) 1	7.949
	CNS0095599	Silvery flower (diploied) 2	6.693
	CNS0095600	Silvery flower (diploied) 3	11.697
	CNS0095601	Golden flower (diploid) 1	8.387
	CNS0095602	Golden flower (diploid) 2	6.017
	CNS0095603	Golden flower (diploid) 3	4.429
	CNS0095604	Slightly white alabastrum(tetraploid) 1	40.627
	CNS0095605	Slightly white alabastrum(tetraploid) 2	52.583
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.131
	CNS0095607	Whole white alabastrum(tetraploid) 1	46.482
	CNS0095608	Whole white alabastrum(tetraploid) 2	44.092
	CNS0095609	Whole white alabastrum(tetraploid) 3	146.619
	CNS0095610	Silvery flower (tetraploid) 1	11.061
	CNS0095611	Silvery flower (tetraploid) 2	23.856
	CNS0095612	Silvery flower (tetraploid) 3	9.082
	CNS0095613	Golden flower (tetraploid) 1	10.135
	CNS0095614	Golden flower (tetraploid) 2	8.164
	CNS0095615	Golden flower (tetraploid) 3	14.292
CRA001975	CRR073297	Stem 1	49.929
	CRR073298	Stem 2	65.035
	CRR073299	Stem 3	58.533
	CRR073300	Leaf 1	35.642
	CRR073301	Leaf 2	34.236
	CRR073302	Leaf 3	76.429
	CRR073303	Juvenile bud 1	14.312
	CRR073304	Juvenile bud 2	8.284
	CRR073305	Juvenile bud 3	11.495
	CRR073306	Third green 1	2.950
	CRR073307	Third green 2	6.005
	CRR073308	Third green 3	4.232
	CRR073309	Second white 1	1.408
	CRR073310	Second white 2	0.993
	CRR073311	Second white 3	1.725
	CRR073312	Silver flowering 1	4.973
	CRR073313	Silver flowering 2	5.866
	CRR073314	Silver flowering 3	3.596
	CRR073315	Gold flowering 1	8.616
	CRR073316	Gold flowering 2	5.142
	CRR073317	Gold flowering 3	11.205
	CRR073318	Tawny withering 1	29.507
	CRR073319	Tawny withering 2	22.942
	CRR073320	Tawny withering 3	30.533