Gene detail

Detail information of GWHGAAZE006147

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007209407.1	3.41573E-27	hypothetical protein PRUPE_ppa009264mg [Prunus persica]
Swissprot	tr\|Q9LQ04\|RMLCD_ARATH	3E-28	Bifunctional dTDP-4-dehydrorhamnose 3,5-epimerase/dTDP-4-dehydrorhamnose reductase {ECO:0000305}
trEMBL	tr\|M0V3R3\|M0V3R3_HORVD	8E-29	Uncharacterized protein {ECO:0000313\|EnsemblPlants:MLOC_17826.1}
TAIR10	AT1G63000.1	2E-23	nucleotide-rhamnose synthase/epimerase-reductase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	20039469	20039666	-
GWHAAZE00000002	mRNA	20039469	20039666	-
GWHAAZE00000002	exon	20039469	20039666	-
GWHAAZE00000002	CDS	20039469	20039666	-

Transcript Sequence
>GWHTAAZE006155 ATGTACCGTGATTACATTGACCCCAAATTCACATGGAAGAATTTTACTCTTGAGGAGCAAGCAAGTGATAGTTGCTCGAGGAGCAACAATGAGCTAGATGCTACCAAATTGAAGACTGAATTCCCCGAACTCTTATCGATTAAGGAGTCCCTAATACAGAATGTGTTCAAGCCTAATCAGAAAACATCTGCAGCTTGA

Network for GWHGAAZE006147

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12451	UER1	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Amino sugar and nucleotide sugar metabolism	map00520
		Polyketide sugar unit biosynthesis	map00523

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	76.434
	SRR3591706	second leaf	55.544
	SRR3591707	mature leaf	38.239
	SRR3591708	Shoot apex	36.475
	SRR3591709	Stem	52.892
	SRR3591710	White floral bud	19.414
	SRR3591711	White flower	6.489
	SRR3591712	Green floral bud	69.256
	SRR3591713	Yellow flower	7.704
SRP173429	SRR8316895	Juvenile bud stage	8.977
	SRR8316896	Juvenile bud stage	7.921
	SRR8316897	Juvenile bud stage	13.638
	SRR8316894	Third green stage	5.368
	SRR8316900	Third green stage	17.920
	SRR8316901	Third green stage	17.283
	SRR8316898	Complete white stage	4.080
	SRR8316899	Complete white stage	15.433
	SRR8316903	Complete white stage	3.993
	SRR8316902	Silver flowering stage	0.842
	SRR8316904	Silver flowering stage	1.554
	SRR8316905	Silver flowering stage	0.440
	SRR8316906	Gold flowering stage	1.111
	SRR8316907	Gold flowering stage	0.951
	SRR8316908	Gold flowering stage	5.111
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.124
	SRR6706288	Light intensity 20%	0.226
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	13.687
	CNS0095593	Slightly white alabastrum(diploid) 2	13.323
	CNS0095594	Slightly white alabastrum(diploid) 3	10.724
	CNS0095595	Whole white alabastrum(diploid) 2	12.605
	CNS0095596	Whole white alabastrum(diploid) 3	11.127
	CNS0095597	Whole white alabastrum(diploid) 4	11.436
	CNS0095598	Silvery flower (diploied) 1	2.152
	CNS0095599	Silvery flower (diploied) 2	2.684
	CNS0095600	Silvery flower (diploied) 3	3.762
	CNS0095601	Golden flower (diploid) 1	2.834
	CNS0095602	Golden flower (diploid) 2	3.490
	CNS0095603	Golden flower (diploid) 3	2.697
	CNS0095604	Slightly white alabastrum(tetraploid) 1	21.405
	CNS0095605	Slightly white alabastrum(tetraploid) 2	16.859
	CNS0095606	Slightly white alabastrum(tetraploid) 3	25.556
	CNS0095607	Whole white alabastrum(tetraploid) 1	16.926
	CNS0095608	Whole white alabastrum(tetraploid) 2	19.320
	CNS0095609	Whole white alabastrum(tetraploid) 3	24.557
	CNS0095610	Silvery flower (tetraploid) 1	4.626
	CNS0095611	Silvery flower (tetraploid) 2	8.487
	CNS0095612	Silvery flower (tetraploid) 3	5.428
	CNS0095613	Golden flower (tetraploid) 1	2.104
	CNS0095614	Golden flower (tetraploid) 2	4.571
	CNS0095615	Golden flower (tetraploid) 3	0.718
CRA001975	CRR073297	Stem 1	3.233
	CRR073298	Stem 2	2.550
	CRR073299	Stem 3	2.996
	CRR073300	Leaf 1	5.774
	CRR073301	Leaf 2	4.679
	CRR073302	Leaf 3	6.195
	CRR073303	Juvenile bud 1	6.297
	CRR073304	Juvenile bud 2	6.038
	CRR073305	Juvenile bud 3	7.605
	CRR073306	Third green 1	1.168
	CRR073307	Third green 2	1.361
	CRR073308	Third green 3	1.316
	CRR073309	Second white 1	0.154
	CRR073310	Second white 2	0.218
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.086
	CRR073313	Silver flowering 2	0.428
	CRR073314	Silver flowering 3	0.334
	CRR073315	Gold flowering 1	4.152
	CRR073316	Gold flowering 2	3.061
	CRR073317	Gold flowering 3	5.122
	CRR073318	Tawny withering 1	7.853
	CRR073319	Tawny withering 2	6.141
	CRR073320	Tawny withering 3	8.898