Gene detail

Detail information of GWHGAAZE006117

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011033804.1	2.0966E-68	PREDICTED: ethylene-responsive transcription factor ERF026-like [Populus euphratica]
Swissprot	tr\|Q9CAN9\|ERF26_ARATH	9E-46	Ethylene-responsive transcription factor ERF026
trEMBL	tr\|B9GW61\|B9GW61_POPTR	8E-69	AP2 domain-containing family protein {ECO:0000313\|EMBL:EEE79445.1}
TAIR10	AT1G12630.1	3E-32	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	19597618	19598118	+
GWHAAZE00000002	mRNA	19597618	19598118	+
GWHAAZE00000002	exon	19597618	19598118	+
GWHAAZE00000002	CDS	19597618	19598118	+

Transcript Sequence
>GWHTAAZE006125 ATGATCTCCACCTCGTCCACCAAAAGACACCCCACGTACCGTGGAATCCGCAGCCGGAGCGGCAAGTGGGTGTCGGAGATTCGGGAACCGCGCAAGACCACACGCATATGGCTTGGGACCTTCCAAACACCCGAGATGGCTGCTGCCGCCTATGACGTGGCGGCACTGGCCCTTAAAGGGAGTGAAGCCGTTGTTAATTTTCCCGAGCATGTCGGGTCTTATCCGGTCCCGGAGACGCACTCGCCTGTGGCGATACGCAGTGCCGCCAGGGCTGCCGCAGCACTGATGAAGGCTTTCACCACGGTTGGTGGGGGACCAGGAACTGATAGTAGTTGCAGTGGAGGACATGAATTTGTGGATGAGGAGGCACTTTTTGGTATGCCTAATTTGCTGGTGGAGATGGCCGGTGGAATGATGGTGAGTCCGCCGAGGATAAACTCGCCGCCGACTGATGAGTCGGGTGGAGATTCTGACGGAGAATCCCTGTGGAGCTATTTTTAA

Network for GWHGAAZE006117

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	12	60	2.90E-10

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.189
	SRR3591710	White floral bud	2.501
	SRR3591711	White flower	14.012
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	7.078
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.156
	SRR8316901	Third green stage	0.230
	SRR8316898	Complete white stage	0.021
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.205
	SRR8316902	Silver flowering stage	7.350
	SRR8316904	Silver flowering stage	3.363
	SRR8316905	Silver flowering stage	1.052
	SRR8316906	Gold flowering stage	2.670
	SRR8316907	Gold flowering stage	6.152
	SRR8316908	Gold flowering stage	1.667
SRP132670	SRR6706286	Control	0.102
	SRR6706287	Light intensity 50%	0.042
	SRR6706288	Light intensity 20%	0.058
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.302
	CNS0095594	Slightly white alabastrum(diploid) 3	0.086
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.201
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	3.204
	CNS0095599	Silvery flower (diploied) 2	1.811
	CNS0095600	Silvery flower (diploied) 3	3.982
	CNS0095601	Golden flower (diploid) 1	0.150
	CNS0095602	Golden flower (diploid) 2	2.096
	CNS0095603	Golden flower (diploid) 3	1.785
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.482
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.292
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.439
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.086
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.230
	CNS0095610	Silvery flower (tetraploid) 1	2.409
	CNS0095611	Silvery flower (tetraploid) 2	0.558
	CNS0095612	Silvery flower (tetraploid) 3	0.272
	CNS0095613	Golden flower (tetraploid) 1	0.878
	CNS0095614	Golden flower (tetraploid) 2	0.613
	CNS0095615	Golden flower (tetraploid) 3	2.277
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.054
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.036
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.082
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	22.566
	CRR073307	Third green 2	35.170
	CRR073308	Third green 3	20.137
	CRR073309	Second white 1	25.081
	CRR073310	Second white 2	22.560
	CRR073311	Second white 3	20.024
	CRR073312	Silver flowering 1	46.650
	CRR073313	Silver flowering 2	30.188
	CRR073314	Silver flowering 3	16.007
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000