Gene detail

Detail information of GWHGAAZE005812

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004246483.1	1.60705E-74	PREDICTED: peptidyl-prolyl cis-trans isomerase CYP18-2 [Solanum lycopersicum]
Swissprot	tr\|Q9SIH1\|CP18B_ARATH	1E-72	Peptidyl-prolyl cis-trans isomerase CYP18-2
trEMBL	tr\|K4CR47\|K4CR47_SOLLC	6E-75	Peptidyl-prolyl cis-trans isomerase {ECO:0000256\|RuleBase:RU000493}
TAIR10	AT2G36130.1	3E-47	Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	14308495	14311486	-
GWHAAZE00000002	mRNA	14308495	14311486	-
GWHAAZE00000002	exon	14311386	14311486	-
GWHAAZE00000002	exon	14311237	14311276	-
GWHAAZE00000002	exon	14311047	14311156	-
GWHAAZE00000002	exon	14309819	14309952	-
GWHAAZE00000002	exon	14308495	14308607	-
GWHAAZE00000002	CDS	14311386	14311486	-
GWHAAZE00000002	CDS	14311237	14311276	-
GWHAAZE00000002	CDS	14311047	14311156	-
GWHAAZE00000002	CDS	14309819	14309952	-
GWHAAZE00000002	CDS	14308495	14308607	-

Transcript Sequence
>GWHTAAZE005820 ATGGCAGAAGGAGGGGCGCCGCCGGAGGTTACTCTTGAGACGTCGGCGGGTTCTTTCACCGTTGAGGTACCACTCCCCCCTCTATGTGTGCTTGCTTGTCTGGGTTACTACGACAACGTCAAATTCCACCGCATCATTAAGAAACCTCTCTCACAATTTACTGACTGTTGGGTTCATGATTTGGAGCAGGATTTTATTATTCAAGGTGGGGATCCCACTGGCACAGGAAGGGGTGGTGAATCTATTTATGGTCCAAAATTTGAGGATGAGATAAACCCAAAGTTAAAGCATACCGGAGCCGGTATTTTATCCATGGCAAATGCTGGTCCAAATACGAATGGAAGCCAGTTCTTTATTACCTTGGCACCAGCACAGTCTCTTGATGGAAAACACACAATATTTGGAAGAGTATGCAGAGGAATGGAAATTATCAAGAGACTTGGCAGTGTCCAAACTGACAACACTGATCGGTACACTTTATCAATTCCAGGGCTTTGA

Network for GWHGAAZE005812

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00160.22	Pro_isomerase	33	157	4.80E-33

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12733	PPIL1	Spliceosome	map03040

Gene Ontology

GO term	Ontology	Name
GO:0000413	biological_process	protein peptidyl-prolyl isomerization
GO:0003755	molecular_function	peptidyl-prolyl cis-trans isomerase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	19.169
	SRR3591706	second leaf	10.315
	SRR3591707	mature leaf	15.867
	SRR3591708	Shoot apex	30.742
	SRR3591709	Stem	19.696
	SRR3591710	White floral bud	18.317
	SRR3591711	White flower	29.049
	SRR3591712	Green floral bud	24.069
	SRR3591713	Yellow flower	18.477
SRP173429	SRR8316895	Juvenile bud stage	19.860
	SRR8316896	Juvenile bud stage	27.267
	SRR8316897	Juvenile bud stage	14.226
	SRR8316894	Third green stage	11.272
	SRR8316900	Third green stage	31.779
	SRR8316901	Third green stage	31.847
	SRR8316898	Complete white stage	14.526
	SRR8316899	Complete white stage	49.658
	SRR8316903	Complete white stage	17.645
	SRR8316902	Silver flowering stage	10.089
	SRR8316904	Silver flowering stage	14.599
	SRR8316905	Silver flowering stage	8.475
	SRR8316906	Gold flowering stage	29.206
	SRR8316907	Gold flowering stage	27.938
	SRR8316908	Gold flowering stage	26.132
SRP132670	SRR6706286	Control	35.681
	SRR6706287	Light intensity 50%	32.248
	SRR6706288	Light intensity 20%	34.413
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	23.010
	CNS0095593	Slightly white alabastrum(diploid) 2	30.065
	CNS0095594	Slightly white alabastrum(diploid) 3	25.091
	CNS0095595	Whole white alabastrum(diploid) 2	21.089
	CNS0095596	Whole white alabastrum(diploid) 3	35.898
	CNS0095597	Whole white alabastrum(diploid) 4	25.935
	CNS0095598	Silvery flower (diploied) 1	23.451
	CNS0095599	Silvery flower (diploied) 2	25.000
	CNS0095600	Silvery flower (diploied) 3	25.041
	CNS0095601	Golden flower (diploid) 1	18.630
	CNS0095602	Golden flower (diploid) 2	26.402
	CNS0095603	Golden flower (diploid) 3	28.910
	CNS0095604	Slightly white alabastrum(tetraploid) 1	33.535
	CNS0095605	Slightly white alabastrum(tetraploid) 2	27.473
	CNS0095606	Slightly white alabastrum(tetraploid) 3	37.465
	CNS0095607	Whole white alabastrum(tetraploid) 1	19.199
	CNS0095608	Whole white alabastrum(tetraploid) 2	20.252
	CNS0095609	Whole white alabastrum(tetraploid) 3	29.764
	CNS0095610	Silvery flower (tetraploid) 1	32.669
	CNS0095611	Silvery flower (tetraploid) 2	35.866
	CNS0095612	Silvery flower (tetraploid) 3	31.448
	CNS0095613	Golden flower (tetraploid) 1	29.397
	CNS0095614	Golden flower (tetraploid) 2	33.742
	CNS0095615	Golden flower (tetraploid) 3	22.004
CRA001975	CRR073297	Stem 1	20.605
	CRR073298	Stem 2	14.309
	CRR073299	Stem 3	16.428
	CRR073300	Leaf 1	18.012
	CRR073301	Leaf 2	16.835
	CRR073302	Leaf 3	15.656
	CRR073303	Juvenile bud 1	19.258
	CRR073304	Juvenile bud 2	17.351
	CRR073305	Juvenile bud 3	17.672
	CRR073306	Third green 1	6.404
	CRR073307	Third green 2	7.898
	CRR073308	Third green 3	5.938
	CRR073309	Second white 1	19.113
	CRR073310	Second white 2	12.122
	CRR073311	Second white 3	9.001
	CRR073312	Silver flowering 1	9.923
	CRR073313	Silver flowering 2	10.903
	CRR073314	Silver flowering 3	6.235
	CRR073315	Gold flowering 1	9.319
	CRR073316	Gold flowering 2	8.152
	CRR073317	Gold flowering 3	11.525
	CRR073318	Tawny withering 1	19.437
	CRR073319	Tawny withering 2	15.080
	CRR073320	Tawny withering 3	14.517