Gene detail

Detail information of GWHGAAZE005744

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009627498.1	1.11405E-62	PREDICTED: ethylene-responsive transcription factor ERF024-like [Nicotiana tomentosiformis]
Swissprot	tr\|Q9SJR0\|ERF24_ARATH	1E-51	Ethylene-responsive transcription factor ERF024
trEMBL	tr\|D7TJ29\|D7TJ29_VITVI	2E-62	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI30255.3}
TAIR10	AT2G36450.1	2E-26	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	13036357	13036854	+
GWHAAZE00000002	mRNA	13036357	13036854	+
GWHAAZE00000002	exon	13036357	13036854	+
GWHAAZE00000002	CDS	13036357	13036854	+

Transcript Sequence
>GWHTAAZE005752 ATGGCGCATTCTAGCAGTAGCTTCAGTGCTTCACTGCCTTCAGATGGGCAACCTCCCGTATCTGGCCGACACCCGACATACCGGGGCGTAAGGCGCAGAAAAAGCAGCGGGAAATGGGTTTCTGAAATCCGCGAGCCGAGATCTCCTAACCGGATTTGGCTTGGCACGTTTCCCACCCCGGAAATGGCAGCTGTGGCGTATGATGTGGCGGCTCGTGCACTTAAAGGAAATGATGCGGAACTTAACTTTCCGGATTCGGCTTCTTCATTGCCTATTCCAGCCTCTAGCTCTCCAAGGGATATTCAGGCTGCGGCTGCCAGTGCAGCAGCCGCTGCTGGAGCGGCTGCAGACGCCCTTATAGGTGGTGGTGGTACTAGGAACCAAACGGAATTACCGAGGGATGGAATGGGGAATAATGAATATTTTGTGGATGAGGATTTGATATTTGATATGCCAAATATGCTAGTGAATATGGCTGAAGGAATGCTTCTTAGCCCT

Network for GWHGAAZE005744

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	26	76	1.20E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	7.521
	SRR3591710	White floral bud	9.511
	SRR3591711	White flower	0.221
	SRR3591712	Green floral bud	36.774
	SRR3591713	Yellow flower	0.122
SRP173429	SRR8316895	Juvenile bud stage	7.462
	SRR8316896	Juvenile bud stage	16.722
	SRR8316897	Juvenile bud stage	7.172
	SRR8316894	Third green stage	5.200
	SRR8316900	Third green stage	32.398
	SRR8316901	Third green stage	33.354
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.288
	SRR8316904	Silver flowering stage	0.269
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	21.051
	SRR6706287	Light intensity 50%	19.108
	SRR6706288	Light intensity 20%	18.480
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	25.849
	CNS0095593	Slightly white alabastrum(diploid) 2	20.157
	CNS0095594	Slightly white alabastrum(diploid) 3	28.828
	CNS0095595	Whole white alabastrum(diploid) 2	56.949
	CNS0095596	Whole white alabastrum(diploid) 3	68.179
	CNS0095597	Whole white alabastrum(diploid) 4	71.217
	CNS0095598	Silvery flower (diploied) 1	0.509
	CNS0095599	Silvery flower (diploied) 2	3.166
	CNS0095600	Silvery flower (diploied) 3	1.317
	CNS0095601	Golden flower (diploid) 1	0.438
	CNS0095602	Golden flower (diploid) 2	0.580
	CNS0095603	Golden flower (diploid) 3	0.355
	CNS0095604	Slightly white alabastrum(tetraploid) 1	36.804
	CNS0095605	Slightly white alabastrum(tetraploid) 2	44.363
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	79.541
	CNS0095608	Whole white alabastrum(tetraploid) 2	69.050
	CNS0095609	Whole white alabastrum(tetraploid) 3	39.156
	CNS0095610	Silvery flower (tetraploid) 1	0.251
	CNS0095611	Silvery flower (tetraploid) 2	0.483
	CNS0095612	Silvery flower (tetraploid) 3	2.955
	CNS0095613	Golden flower (tetraploid) 1	0.220
	CNS0095614	Golden flower (tetraploid) 2	0.297
	CNS0095615	Golden flower (tetraploid) 3	1.287
CRA001975	CRR073297	Stem 1	7.500
	CRR073298	Stem 2	6.992
	CRR073299	Stem 3	4.491
	CRR073300	Leaf 1	22.175
	CRR073301	Leaf 2	15.103
	CRR073302	Leaf 3	8.481
	CRR073303	Juvenile bud 1	11.018
	CRR073304	Juvenile bud 2	12.786
	CRR073305	Juvenile bud 3	1.151
	CRR073306	Third green 1	1.849
	CRR073307	Third green 2	2.242
	CRR073308	Third green 3	3.135
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.395
	CRR073311	Second white 3	0.224
	CRR073312	Silver flowering 1	1.108
	CRR073313	Silver flowering 2	0.915
	CRR073314	Silver flowering 3	0.536
	CRR073315	Gold flowering 1	2.923
	CRR073316	Gold flowering 2	0.482
	CRR073317	Gold flowering 3	0.631
	CRR073318	Tawny withering 1	5.668
	CRR073319	Tawny withering 2	5.942
	CRR073320	Tawny withering 3	5.695