Gene detail

Detail information of GWHGAAZE005548

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI24316.3	7.68523E-92	unnamed protein product [Vitis vinifera]
Swissprot	tr\|O22827\|MOC2B_ARATH	7E-87	Molybdopterin synthase catalytic subunit {ECO:0000255\|HAMAP-Rule:MF_03052}
trEMBL	tr\|F6HAF9\|F6HAF9_VITVI	2E-90	Molybdopterin synthase catalytic subunit {ECO:0000256\|HAMAP-Rule:MF_03052}
TAIR10	AT2G43760.3	3E-69	molybdopterin biosynthesis MoaE family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	9817238	9817777	-
GWHAAZE00000002	mRNA	9817238	9817777	-
GWHAAZE00000002	exon	9817238	9817777	-
GWHAAZE00000002	CDS	9817238	9817777	-

Transcript Sequence
>GWHTAAZE005556 ATGGCCAATGAGGGGAAAAATTTAATCGAAATCCTAGAAGAGAATAACCCTATCGACATCTCCAAGTACATGAATTATGTCCACTCTCAACAATGCGGTGCTATAGCAACTTTCTCCGGCACAACCCGAGATGCCTTTCAGGGAAAAACAGTAGTGGAGCTACGCTACGAAGCATATGTGCCCATGGCAGTACGCTGCATTGAGTCGATCTGTTCGTTCGCCCGATCATCATGGTCCCTCAATGCAATTGCGGTGGCCCATCGTCTGGGACCAGTCCCAGTAGGGGAAACGAGCGTGCTTATTGTGATTTCGGCTGTTCATAGGGCTGATGCGCTGGACGCGTGTAAGTATGTGATTGATGAGATCAAGGCATCAGTTCCTATATGGAAGAAGGAAGTTTACGCCAATGGGGAAGTTTGGAAGGAGAATTCAGAGTTTTTGGAGAGAAGAGGGGAACTTAAAAAGGGTTGCTGCGGGATGAAGGTAAAGGTAGATGATGGAGCACTGAATTCTTGCCCTGCTAAAGGAGGAGGGATTTGA

Network for GWHGAAZE005548

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02391.18	MoaE	15	124	7.90E-39

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03635	MOCS2B, moaE	Metabolic pathways	map01100
		Folate biosynthesis	map00790
		Sulfur relay system	map04122

Gene Ontology

GO term	Ontology	Name
GO:0006777	biological_process	Mo-molybdopterin cofactor biosynthetic process
GO:0005829	cellular_component	cytosol
GO:0019008	cellular_component	molybdopterin synthase complex
GO:0030366	molecular_function	molybdopterin synthase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.463
	SRR3591706	second leaf	0.211
	SRR3591707	mature leaf	0.320
	SRR3591708	Shoot apex	1.177
	SRR3591709	Stem	0.150
	SRR3591710	White floral bud	1.147
	SRR3591711	White flower	0.755
	SRR3591712	Green floral bud	0.740
	SRR3591713	Yellow flower	0.481
SRP173429	SRR8316895	Juvenile bud stage	13.928
	SRR8316896	Juvenile bud stage	16.462
	SRR8316897	Juvenile bud stage	8.548
	SRR8316894	Third green stage	6.530
	SRR8316900	Third green stage	18.201
	SRR8316901	Third green stage	17.326
	SRR8316898	Complete white stage	5.847
	SRR8316899	Complete white stage	24.816
	SRR8316903	Complete white stage	8.930
	SRR8316902	Silver flowering stage	5.230
	SRR8316904	Silver flowering stage	6.265
	SRR8316905	Silver flowering stage	4.003
	SRR8316906	Gold flowering stage	13.887
	SRR8316907	Gold flowering stage	8.366
	SRR8316908	Gold flowering stage	10.868
SRP132670	SRR6706286	Control	25.382
	SRR6706287	Light intensity 50%	20.915
	SRR6706288	Light intensity 20%	23.715
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.112
	CNS0095593	Slightly white alabastrum(diploid) 2	18.139
	CNS0095594	Slightly white alabastrum(diploid) 3	14.233
	CNS0095595	Whole white alabastrum(diploid) 2	19.405
	CNS0095596	Whole white alabastrum(diploid) 3	18.342
	CNS0095597	Whole white alabastrum(diploid) 4	15.404
	CNS0095598	Silvery flower (diploied) 1	18.924
	CNS0095599	Silvery flower (diploied) 2	13.600
	CNS0095600	Silvery flower (diploied) 3	11.508
	CNS0095601	Golden flower (diploid) 1	18.481
	CNS0095602	Golden flower (diploid) 2	13.195
	CNS0095603	Golden flower (diploid) 3	13.485
	CNS0095604	Slightly white alabastrum(tetraploid) 1	18.926
	CNS0095605	Slightly white alabastrum(tetraploid) 2	17.875
	CNS0095606	Slightly white alabastrum(tetraploid) 3	17.466
	CNS0095607	Whole white alabastrum(tetraploid) 1	15.891
	CNS0095608	Whole white alabastrum(tetraploid) 2	19.386
	CNS0095609	Whole white alabastrum(tetraploid) 3	16.366
	CNS0095610	Silvery flower (tetraploid) 1	12.337
	CNS0095611	Silvery flower (tetraploid) 2	15.645
	CNS0095612	Silvery flower (tetraploid) 3	15.423
	CNS0095613	Golden flower (tetraploid) 1	11.052
	CNS0095614	Golden flower (tetraploid) 2	13.790
	CNS0095615	Golden flower (tetraploid) 3	9.726
CRA001975	CRR073297	Stem 1	19.756
	CRR073298	Stem 2	18.465
	CRR073299	Stem 3	13.915
	CRR073300	Leaf 1	22.053
	CRR073301	Leaf 2	18.839
	CRR073302	Leaf 3	19.309
	CRR073303	Juvenile bud 1	22.210
	CRR073304	Juvenile bud 2	14.274
	CRR073305	Juvenile bud 3	18.600
	CRR073306	Third green 1	7.247
	CRR073307	Third green 2	7.436
	CRR073308	Third green 3	4.613
	CRR073309	Second white 1	7.005
	CRR073310	Second white 2	5.526
	CRR073311	Second white 3	2.885
	CRR073312	Silver flowering 1	2.103
	CRR073313	Silver flowering 2	3.850
	CRR073314	Silver flowering 3	3.883
	CRR073315	Gold flowering 1	10.721
	CRR073316	Gold flowering 2	13.600
	CRR073317	Gold flowering 3	12.614
	CRR073318	Tawny withering 1	15.375
	CRR073319	Tawny withering 2	15.834
	CRR073320	Tawny withering 3	15.945