Gene detail

Detail information of GWHGAAZE005462

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	NP_001048679.2	2.96278E-46	Os03g0105600 [Oryza sativa Japonica Group]
Swissprot	tr\|Q9ASR0\|TBB3_ARATH	7E-47	Tubulin beta-3 chain
trEMBL	tr\|Q0DVZ5\|Q0DVZ5_ORYSJ	1E-46	Os03g0105600 protein {ECO:0000313\|EMBL:BAF10593.2}
TAIR10	AT5G62700.1	1E-39	tubulin beta chain 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	8355401	8355903	+
GWHAAZE00000002	mRNA	8355401	8355903	+
GWHAAZE00000002	exon	8355401	8355623	+
GWHAAZE00000002	exon	8355854	8355903	+
GWHAAZE00000002	CDS	8355401	8355623	+
GWHAAZE00000002	CDS	8355854	8355903	+

Transcript Sequence
>GWHTAAZE005470 ATGCGTGAGATCCTTCACATCCAAGGAGGCCAATGCGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGGTTTGTGCCGAACACGGCATAGATTCCACCGGAAGGTACCAAGGAGACTCAGATCTACAGCTCGAGAGGATCAATGTCTATTACAATGAAGCGAGTTGTGGGAGGTACGTACCGAGGGCTGTACTCATGGATCTGGAGCCTGGAACTATGGACAATCTTTGCCCCGAACCCACAATTTTCTCGTATGGAGTCCACAATACATGA

Network for GWHGAAZE005462

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00091.26	Tubulin	3	79	5.90E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07375	TUBB	Phagosome	map04145
K07375	TUBB	Gap junction	map04540

Gene Ontology

GO term	Ontology	Name
GO:0007017	biological_process	microtubule-based process
GO:0005874	cellular_component	microtubule
GO:0003924	molecular_function	GTPase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	163.195
	SRR3591706	second leaf	71.716
	SRR3591707	mature leaf	27.684
	SRR3591708	Shoot apex	217.391
	SRR3591709	Stem	67.949
	SRR3591710	White floral bud	86.958
	SRR3591711	White flower	64.534
	SRR3591712	Green floral bud	84.967
	SRR3591713	Yellow flower	34.043
SRP173429	SRR8316895	Juvenile bud stage	60.843
	SRR8316896	Juvenile bud stage	66.938
	SRR8316897	Juvenile bud stage	29.190
	SRR8316894	Third green stage	38.607
	SRR8316900	Third green stage	82.200
	SRR8316901	Third green stage	81.601
	SRR8316898	Complete white stage	42.218
	SRR8316899	Complete white stage	90.145
	SRR8316903	Complete white stage	71.379
	SRR8316902	Silver flowering stage	22.742
	SRR8316904	Silver flowering stage	32.676
	SRR8316905	Silver flowering stage	16.183
	SRR8316906	Gold flowering stage	63.311
	SRR8316907	Gold flowering stage	80.657
	SRR8316908	Gold flowering stage	76.375
SRP132670	SRR6706286	Control	115.683
	SRR6706287	Light intensity 50%	115.957
	SRR6706288	Light intensity 20%	142.899
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	71.306
	CNS0095593	Slightly white alabastrum(diploid) 2	90.519
	CNS0095594	Slightly white alabastrum(diploid) 3	72.363
	CNS0095595	Whole white alabastrum(diploid) 2	58.884
	CNS0095596	Whole white alabastrum(diploid) 3	47.908
	CNS0095597	Whole white alabastrum(diploid) 4	53.423
	CNS0095598	Silvery flower (diploied) 1	45.157
	CNS0095599	Silvery flower (diploied) 2	47.240
	CNS0095600	Silvery flower (diploied) 3	99.531
	CNS0095601	Golden flower (diploid) 1	22.965
	CNS0095602	Golden flower (diploid) 2	74.203
	CNS0095603	Golden flower (diploid) 3	64.735
	CNS0095604	Slightly white alabastrum(tetraploid) 1	89.663
	CNS0095605	Slightly white alabastrum(tetraploid) 2	78.069
	CNS0095606	Slightly white alabastrum(tetraploid) 3	197.671
	CNS0095607	Whole white alabastrum(tetraploid) 1	47.125
	CNS0095608	Whole white alabastrum(tetraploid) 2	37.858
	CNS0095609	Whole white alabastrum(tetraploid) 3	92.530
	CNS0095610	Silvery flower (tetraploid) 1	103.281
	CNS0095611	Silvery flower (tetraploid) 2	84.354
	CNS0095612	Silvery flower (tetraploid) 3	85.693
	CNS0095613	Golden flower (tetraploid) 1	40.888
	CNS0095614	Golden flower (tetraploid) 2	81.990
	CNS0095615	Golden flower (tetraploid) 3	36.105
CRA001975	CRR073297	Stem 1	144.360
	CRR073298	Stem 2	141.300
	CRR073299	Stem 3	196.960
	CRR073300	Leaf 1	131.483
	CRR073301	Leaf 2	135.423
	CRR073302	Leaf 3	134.418
	CRR073303	Juvenile bud 1	148.264
	CRR073304	Juvenile bud 2	154.774
	CRR073305	Juvenile bud 3	197.575
	CRR073306	Third green 1	130.364
	CRR073307	Third green 2	109.073
	CRR073308	Third green 3	126.922
	CRR073309	Second white 1	140.216
	CRR073310	Second white 2	92.907
	CRR073311	Second white 3	65.762
	CRR073312	Silver flowering 1	59.923
	CRR073313	Silver flowering 2	84.770
	CRR073314	Silver flowering 3	62.824
	CRR073315	Gold flowering 1	65.375
	CRR073316	Gold flowering 2	77.162
	CRR073317	Gold flowering 3	82.356
	CRR073318	Tawny withering 1	187.554
	CRR073319	Tawny withering 2	121.223
	CRR073320	Tawny withering 3	203.478