Gene detail

Detail information of GWHGAAZE005302

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002303624.1	1.23621E-87	ubiquitin conjugating-like enzyme family protein [Populus trichocarpa]
Swissprot	tr\|P35135\|UBC4_SOLLC	9E-89	Ubiquitin-conjugating enzyme E2-17 kDa
trEMBL	tr\|V5V0P4\|V5V0P4_9MAGN	5E-88	Ubiquitin conjugating enzyme 9 {ECO:0000313\|EMBL:AHB86964.1}
TAIR10	AT1G64230.3	9E-70	ubiquitin-conjugating enzyme 28

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	5762000	5766685	+
GWHAAZE00000002	mRNA	5762000	5766685	+
GWHAAZE00000002	exon	5762000	5762149	+
GWHAAZE00000002	exon	5765694	5765798	+
GWHAAZE00000002	exon	5766542	5766685	+
GWHAAZE00000002	CDS	5762000	5762149	+
GWHAAZE00000002	CDS	5765694	5765798	+
GWHAAZE00000002	CDS	5766542	5766685	+

Transcript Sequence
>GWHTAAZE005308 TTGTTTATTTTGTTGGGAACAGGACCTGTTGCTGAAGACATGTTCCACTGGCAAGCAACTATCATGGGCCCCGGTGATAGCCCATATGCGGGAGGTGTTTTCTTAGTTACTATTCATTTCCCTCCTGATTATCCTTTCAAGCCCCCTAAGGTTGCATTTAAGACTAAGGTCTTCCACCCGAACATCAATAGCAACGGAAGTATTTGTCTTGATATCCTCAAAGAACAGTGGAGCCCTGCTCTTACCATCTCTAAGGTGCTGCTCTCTATCTGCTCGTTGCTAACGGATCCGAATCCCGATGATCCTCTCGTACCTGAGATCGCTCACATGTACAAGACCGATCGGTCCAAGTACGAGACCACTGCCCGTAGCTGGACACAGAAGTATGCTATGGGATGA

Network for GWHGAAZE005302

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00179.27	UQ_con	8	125	1.30E-48

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	UBC

KEGG pathway

KO	Enzyme	pathway	mapID
K06689	UBE2D, UBC4, UBC5	Protein processing in endoplasmic reticulum	map04141
		Ubiquitin mediated proteolysis	map04120
		MAPK signaling pathway - fly	map04013
		Toll and Imd signaling pathway	map04624

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	248.936
	SRR3591706	second leaf	144.581
	SRR3591707	mature leaf	140.736
	SRR3591708	Shoot apex	223.362
	SRR3591709	Stem	275.247
	SRR3591710	White floral bud	294.510
	SRR3591711	White flower	265.325
	SRR3591712	Green floral bud	242.609
	SRR3591713	Yellow flower	311.718
SRP173429	SRR8316895	Juvenile bud stage	136.070
	SRR8316896	Juvenile bud stage	185.352
	SRR8316897	Juvenile bud stage	83.792
	SRR8316894	Third green stage	64.023
	SRR8316900	Third green stage	246.724
	SRR8316901	Third green stage	290.390
	SRR8316898	Complete white stage	194.854
	SRR8316899	Complete white stage	532.069
	SRR8316903	Complete white stage	234.666
	SRR8316902	Silver flowering stage	176.211
	SRR8316904	Silver flowering stage	179.406
	SRR8316905	Silver flowering stage	94.877
	SRR8316906	Gold flowering stage	241.200
	SRR8316907	Gold flowering stage	259.494
	SRR8316908	Gold flowering stage	268.807
SRP132670	SRR6706286	Control	203.795
	SRR6706287	Light intensity 50%	182.794
	SRR6706288	Light intensity 20%	208.358
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	207.238
	CNS0095593	Slightly white alabastrum(diploid) 2	234.012
	CNS0095594	Slightly white alabastrum(diploid) 3	210.285
	CNS0095595	Whole white alabastrum(diploid) 2	240.035
	CNS0095596	Whole white alabastrum(diploid) 3	235.302
	CNS0095597	Whole white alabastrum(diploid) 4	218.047
	CNS0095598	Silvery flower (diploied) 1	249.485
	CNS0095599	Silvery flower (diploied) 2	250.665
	CNS0095600	Silvery flower (diploied) 3	412.047
	CNS0095601	Golden flower (diploid) 1	268.804
	CNS0095602	Golden flower (diploid) 2	391.937
	CNS0095603	Golden flower (diploid) 3	367.951
	CNS0095604	Slightly white alabastrum(tetraploid) 1	187.025
	CNS0095605	Slightly white alabastrum(tetraploid) 2	185.279
	CNS0095606	Slightly white alabastrum(tetraploid) 3	215.283
	CNS0095607	Whole white alabastrum(tetraploid) 1	198.300
	CNS0095608	Whole white alabastrum(tetraploid) 2	193.869
	CNS0095609	Whole white alabastrum(tetraploid) 3	208.283
	CNS0095610	Silvery flower (tetraploid) 1	250.439
	CNS0095611	Silvery flower (tetraploid) 2	388.546
	CNS0095612	Silvery flower (tetraploid) 3	286.897
	CNS0095613	Golden flower (tetraploid) 1	239.858
	CNS0095614	Golden flower (tetraploid) 2	277.913
	CNS0095615	Golden flower (tetraploid) 3	537.394
CRA001975	CRR073297	Stem 1	227.303
	CRR073298	Stem 2	219.314
	CRR073299	Stem 3	235.142
	CRR073300	Leaf 1	290.614
	CRR073301	Leaf 2	302.208
	CRR073302	Leaf 3	286.565
	CRR073303	Juvenile bud 1	330.797
	CRR073304	Juvenile bud 2	292.467
	CRR073305	Juvenile bud 3	314.087
	CRR073306	Third green 1	271.519
	CRR073307	Third green 2	303.072
	CRR073308	Third green 3	263.984
	CRR073309	Second white 1	271.531
	CRR073310	Second white 2	234.921
	CRR073311	Second white 3	160.446
	CRR073312	Silver flowering 1	233.284
	CRR073313	Silver flowering 2	280.790
	CRR073314	Silver flowering 3	196.105
	CRR073315	Gold flowering 1	167.660
	CRR073316	Gold flowering 2	192.187
	CRR073317	Gold flowering 3	170.491
	CRR073318	Tawny withering 1	305.526
	CRR073319	Tawny withering 2	286.741
	CRR073320	Tawny withering 3	328.978