Gene detail

Detail information of GWHGAAZE004967

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO80040.1	1.28189E-41	hypothetical protein CISIN_1g010206mg [Citrus sinensis]
Swissprot	tr\|Q38821\|2ABA_ARATH	5E-42	Serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform
trEMBL	tr\|M0Z8S5\|M0Z8S5_HORVD	2E-42	Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B {ECO:0000256\|RuleBase:RU331113}
TAIR10	AT1G51690.2	9E-36	protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	329335	330434	-
GWHAAZE00000002	mRNA	329335	330434	-
GWHAAZE00000002	exon	330314	330434	-
GWHAAZE00000002	exon	329335	329462	-
GWHAAZE00000002	CDS	330314	330434	-
GWHAAZE00000002	CDS	329335	329462	-

Transcript Sequence
>GWHTAAZE004973 AGTGATGGTGAAACTTTTATTTCGGTTGATGATCTGCGAATAAACCTTTGGAACTTGGAAATTAGTAATAAGAGTTTCAATATTGTTGATGTAAAGCCAGCAAACATGGAGGAGCTAACTGATGTGATGACATCAGCAAAATTTCATCCTACCCATTGTAACATGTTGGCTTATAGTAGTTCAAGAGGTTCAATTCGTCTTATTGATTTGTGGCAATTAGCTTTATGCAATACAGATTCTAAATTGTAA

Network for GWHGAAZE004967

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K04354	PPP2R2	mRNA surveillance pathway	map03015
		Hippo signaling pathway	map04390
		Hippo signaling pathway - fly	map04391
		Sphingolipid signaling pathway	map04071
		PI3K-Akt signaling pathway	map04151
		AMPK signaling pathway	map04152
		Cell cycle - yeast	map04111
		Tight junction	map04530
		Adrenergic signaling in cardiomyocytes	map04261
		Dopaminergic synapse	map04728

Gene Ontology

GO term	Ontology	Name
GO:0000159	cellular_component	protein phosphatase type 2A complex
GO:0005515	molecular_function	protein binding
GO:0019888	molecular_function	protein phosphatase regulator activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.337
	SRR3591706	second leaf	0.294
	SRR3591707	mature leaf	0.221
	SRR3591708	Shoot apex	0.063
	SRR3591709	Stem	0.842
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.303
	SRR3591712	Green floral bud	0.391
	SRR3591713	Yellow flower	0.323
SRP173429	SRR8316895	Juvenile bud stage	0.592
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	1.231
	SRR8316894	Third green stage	0.275
	SRR8316900	Third green stage	0.169
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.165
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.435
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.021
	SRR6706288	Light intensity 20%	0.049
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.994
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.712
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.406
	CNS0095598	Silvery flower (diploied) 1	0.104
	CNS0095599	Silvery flower (diploied) 2	0.659
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.151
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.477
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.046
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.134
	CNS0095615	Golden flower (tetraploid) 3	0.078
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.168
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.428
	CRR073320	Tawny withering 3	0.000