Gene detail

Detail information of GWHGAAZE004950

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011086318.1	4.49099E-94	PREDICTED: isocitrate dehydrogenase [NADP] isoform X2 [Sesamum indicum]
Swissprot	tr\|P50217\|IDHC_SOLTU	2E-87	Isocitrate dehydrogenase [NADP]
trEMBL	tr\|W9QYR1\|W9QYR1_9ROSA	1E-93	Isocitrate dehydrogenase [NADP] {ECO:0000256\|PIRNR:PIRNR000108}
TAIR10	AT1G65930.1	1E-71	cytosolic NADP+-dependent isocitrate dehydrogenase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	125021744	125023035	-
GWHAAZE00000001	mRNA	125021744	125023035	-
GWHAAZE00000001	exon	125021744	125021837	-
GWHAAZE00000001	exon	125022156	125022289	-
GWHAAZE00000001	exon	125022388	125022422	-
GWHAAZE00000001	exon	125022553	125022668	-
GWHAAZE00000001	exon	125022743	125022811	-
GWHAAZE00000001	exon	125022959	125023035	-
GWHAAZE00000001	CDS	125022959	125023035	-
GWHAAZE00000001	CDS	125022743	125022811	-
GWHAAZE00000001	CDS	125022553	125022668	-
GWHAAZE00000001	CDS	125022388	125022422	-
GWHAAZE00000001	CDS	125022156	125022289	-
GWHAAZE00000001	CDS	125021744	125021837	-

Transcript Sequence
>GWHTAAZE004956 ATGACCACAGCTTACCAGAAACGGTGGCCACTTTATCTTGGCACCAAAAATACTATAGTTAAAAAATATGATGGAAGATTCATTAATGTTTTCCAACAAGTTTATGAAAAAGGTTGGAGATCCAAGTTTGACTCCGCAGGGATCTGGTATGAACAACGTCTTATAGATGATATGGTTGCTTTTGCGCTTAAGAGTGAGGGAGGTTACGTATGGGCATGCAAGAACTACGATGGAGACGTTCAAAGTGATTTTCTGGCCCAAGGGTTTGGATCATTGGGTTTGATGACATCTGTACTGATGGAAAGACTATCGAAGCTGAAGCAGGCCCATGGCACAGTTACTCGTCATTACCGAGTTCATCAAAAAGGAGGGGAAACTAGCACTAACAGCATAGCTTCAATCTTTGCATGGTCACGAGGGCTTGCCCACAGGGTTACTAAGGCTCAATATTTGAATACTGAGGAACTCATCAATGCTGTGGCTGAGGAGTTGAGAGCAAGACTATCCCAGAAAGCAAAGTTGTAA

Network for GWHGAAZE004950

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00180.21	Iso_dh	2	167	1.20E-32

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00031	IDH1, IDH2, icd	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Microbial metabolism in diverse environments	map01120
		Carbon metabolism	map01200
		2-Oxocarboxylic acid metabolism	map01210
		Biosynthesis of amino acids	map01230
		Citrate cycle	map00020
		Carbon fixation pathways in prokaryotes	map00720
		Glutathione metabolism	map00480
		Peroxisome	map04146

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0000287	molecular_function	magnesium ion binding
GO:0016616	molecular_function	oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor
GO:0051287	molecular_function	NAD binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.920
	SRR3591706	second leaf	0.381
	SRR3591707	mature leaf	0.422
	SRR3591708	Shoot apex	1.176
	SRR3591709	Stem	0.208
	SRR3591710	White floral bud	0.266
	SRR3591711	White flower	1.410
	SRR3591712	Green floral bud	1.572
	SRR3591713	Yellow flower	0.979
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.032
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.170
	SRR8316901	Third green stage	0.037
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.085
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.041
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.024
	SRR6706288	Light intensity 20%	0.079
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.137
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.090
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.029
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.087
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.052
	CRR073298	Stem 2	0.069
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.297
	CRR073301	Leaf 2	0.141
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.144
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.159
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.043
	CRR073308	Third green 3	0.098
	CRR073309	Second white 1	0.032
	CRR073310	Second white 2	0.069
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.156
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.064