Gene detail

Detail information of GWHGAAZE004785

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_003581425.1	5.71835E-21	PREDICTED: putative receptor-like protein kinase At4g00960 [Brachypodium distachyon]
Swissprot	tr\|Q9XEC6\|CRK36_ARATH	1E-19	Cysteine-rich receptor-like protein kinase 36 (Precursor)
trEMBL	tr\|I1IWG1\|I1IWG1_BRADI	2E-21	Uncharacterized protein {ECO:0000313\|EnsemblPlants:BRADI5G03937.1}
TAIR10	AT4G04540.1	6E-14	cysteine-rich RLK (RECEPTOR-like protein kinase) 39

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	122246535	122253675	-
GWHAAZE00000001	mRNA	122246535	122253675	-
GWHAAZE00000001	exon	122253533	122253675	-
GWHAAZE00000001	exon	122246535	122246727	-
GWHAAZE00000001	CDS	122253533	122253675	-
GWHAAZE00000001	CDS	122246535	122246727	-

Transcript Sequence
>GWHTAAZE004791 ATGCGAATTATGCATCGTGATATCACACCTAGCAACATTCTACTAGATACAGAGATGAACCTGAAAATTTCTGATTTTTGCTTGTCAAAGTTGTGTGATTGGGAAGGAAGCGAAGGGTCAGCCAGCGGTGTTGTGGGGACTAAGGGTTACATAGCACCAGAGTGGCTTAGGCAGTTGCGCATCTCAGTCAAATCAGATGTGTTTGGCTTTGGTAAAGTTGTCAAAGAATCTCTGATTTTCAAACTGAGGGAATCCAGGAATAGACTTGGTTTTACTATTATGTTGCTTCACGGGGTATACTTATCAATTTGGGAGAGGGACAAACTTGTACGTTAG

Network for GWHGAAZE004785

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	1	79	1.00E-18

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_DLSV

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.052
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.220
	SRR3591708	Shoot apex	0.889
	SRR3591709	Stem	1.514
	SRR3591710	White floral bud	0.777
	SRR3591711	White flower	1.259
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	1.069
SRP173429	SRR8316895	Juvenile bud stage	1.434
	SRR8316896	Juvenile bud stage	2.797
	SRR8316897	Juvenile bud stage	0.365
	SRR8316894	Third green stage	0.347
	SRR8316900	Third green stage	1.386
	SRR8316901	Third green stage	0.570
	SRR8316898	Complete white stage	0.478
	SRR8316899	Complete white stage	0.091
	SRR8316903	Complete white stage	0.620
	SRR8316902	Silver flowering stage	0.309
	SRR8316904	Silver flowering stage	0.607
	SRR8316905	Silver flowering stage	0.800
	SRR8316906	Gold flowering stage	0.767
	SRR8316907	Gold flowering stage	0.347
	SRR8316908	Gold flowering stage	1.262
SRP132670	SRR6706286	Control	0.196
	SRR6706287	Light intensity 50%	0.105
	SRR6706288	Light intensity 20%	0.155
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.149
	CNS0095593	Slightly white alabastrum(diploid) 2	0.120
	CNS0095594	Slightly white alabastrum(diploid) 3	2.185
	CNS0095595	Whole white alabastrum(diploid) 2	0.860
	CNS0095596	Whole white alabastrum(diploid) 3	0.282
	CNS0095597	Whole white alabastrum(diploid) 4	0.238
	CNS0095598	Silvery flower (diploied) 1	2.413
	CNS0095599	Silvery flower (diploied) 2	5.531
	CNS0095600	Silvery flower (diploied) 3	4.266
	CNS0095601	Golden flower (diploid) 1	4.592
	CNS0095602	Golden flower (diploid) 2	2.706
	CNS0095603	Golden flower (diploid) 3	3.772
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.288
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.184
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.027
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.049
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.659
	CNS0095610	Silvery flower (tetraploid) 1	2.091
	CNS0095611	Silvery flower (tetraploid) 2	2.291
	CNS0095612	Silvery flower (tetraploid) 3	0.291
	CNS0095613	Golden flower (tetraploid) 1	1.269
	CNS0095614	Golden flower (tetraploid) 2	0.486
	CNS0095615	Golden flower (tetraploid) 3	2.010
CRA001975	CRR073297	Stem 1	0.795
	CRR073298	Stem 2	0.098
	CRR073299	Stem 3	0.595
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.238
	CRR073302	Leaf 3	0.013
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.022
	CRR073305	Juvenile bud 3	0.082
	CRR073306	Third green 1	0.035
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.030
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	1.145
	CRR073319	Tawny withering 2	0.763
	CRR073320	Tawny withering 3	0.003