Gene detail

Detail information of GWHGAAZE004759

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU27869.1	6.58369E-38	hypothetical protein MIMGU_mgv1a017829mg, partial [Erythranthe guttata]
Swissprot	tr\|D6NTT4\|SD18_ARATH	1E-33	Receptor-like serine/threonine-protein kinase SD1-8 (Precursor)
trEMBL	tr\|A0A022QJW6\|A0A022QJW6_ERYGU	2E-38	Uncharacterized protein {ECO:0000313\|EMBL:EYU27869.1} (Fragment)
TAIR10	AT4G21380.1	4E-29	receptor kinase 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	121729476	121729676	+
GWHAAZE00000001	mRNA	121729476	121729676	+
GWHAAZE00000001	exon	121729476	121729676	+
GWHAAZE00000001	CDS	121729476	121729676	+

Transcript Sequence
>GWHTAAZE004765 TTCAACATCATTTGTGGAATTGCTCGAGGACTTCTCTATCTTCACCAAGATTCGCGATTTAGGATCATTCACAGGGATCTCAAAGCAAGCAACATTCTACTCGATAAAGAAATGAACCCCAAAATATCAGACTTTGGCATGGCAAGAATTTTTGGAGGAGATCAGATTGAAGCAAATACAAAGCGAGTAGTAGGAACATAG

Network for GWHGAAZE004759

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	2	65	3.70E-15

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_DLSV

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	15.402
	SRR3591706	second leaf	7.387
	SRR3591707	mature leaf	4.933
	SRR3591708	Shoot apex	10.855
	SRR3591709	Stem	24.529
	SRR3591710	White floral bud	9.320
	SRR3591711	White flower	15.732
	SRR3591712	Green floral bud	4.617
	SRR3591713	Yellow flower	13.760
SRP173429	SRR8316895	Juvenile bud stage	1.333
	SRR8316896	Juvenile bud stage	2.802
	SRR8316897	Juvenile bud stage	1.094
	SRR8316894	Third green stage	1.280
	SRR8316900	Third green stage	0.745
	SRR8316901	Third green stage	1.932
	SRR8316898	Complete white stage	3.117
	SRR8316899	Complete white stage	6.264
	SRR8316903	Complete white stage	3.535
	SRR8316902	Silver flowering stage	4.898
	SRR8316904	Silver flowering stage	10.790
	SRR8316905	Silver flowering stage	2.845
	SRR8316906	Gold flowering stage	20.913
	SRR8316907	Gold flowering stage	21.052
	SRR8316908	Gold flowering stage	18.969
SRP132670	SRR6706286	Control	0.312
	SRR6706287	Light intensity 50%	0.434
	SRR6706288	Light intensity 20%	0.307
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.806
	CNS0095593	Slightly white alabastrum(diploid) 2	3.079
	CNS0095594	Slightly white alabastrum(diploid) 3	1.273
	CNS0095595	Whole white alabastrum(diploid) 2	3.446
	CNS0095596	Whole white alabastrum(diploid) 3	1.543
	CNS0095597	Whole white alabastrum(diploid) 4	2.057
	CNS0095598	Silvery flower (diploied) 1	5.780
	CNS0095599	Silvery flower (diploied) 2	4.247
	CNS0095600	Silvery flower (diploied) 3	3.984
	CNS0095601	Golden flower (diploid) 1	8.070
	CNS0095602	Golden flower (diploid) 2	4.762
	CNS0095603	Golden flower (diploid) 3	5.531
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.138
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.100
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.772
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.402
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.370
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.230
	CNS0095610	Silvery flower (tetraploid) 1	8.506
	CNS0095611	Silvery flower (tetraploid) 2	4.057
	CNS0095612	Silvery flower (tetraploid) 3	5.860
	CNS0095613	Golden flower (tetraploid) 1	3.030
	CNS0095614	Golden flower (tetraploid) 2	5.775
	CNS0095615	Golden flower (tetraploid) 3	1.309
CRA001975	CRR073297	Stem 1	0.305
	CRR073298	Stem 2	0.983
	CRR073299	Stem 3	0.462
	CRR073300	Leaf 1	1.260
	CRR073301	Leaf 2	0.805
	CRR073302	Leaf 3	0.514
	CRR073303	Juvenile bud 1	0.207
	CRR073304	Juvenile bud 2	0.361
	CRR073305	Juvenile bud 3	0.853
	CRR073306	Third green 1	5.119
	CRR073307	Third green 2	3.680
	CRR073308	Third green 3	4.467
	CRR073309	Second white 1	1.766
	CRR073310	Second white 2	6.902
	CRR073311	Second white 3	2.309
	CRR073312	Silver flowering 1	2.990
	CRR073313	Silver flowering 2	3.388
	CRR073314	Silver flowering 3	4.155
	CRR073315	Gold flowering 1	4.572
	CRR073316	Gold flowering 2	3.352
	CRR073317	Gold flowering 3	3.070
	CRR073318	Tawny withering 1	12.672
	CRR073319	Tawny withering 2	8.699
	CRR073320	Tawny withering 3	5.389