Gene detail

Detail information of GWHGAAZE004702

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002316635.1	2.12159E-82	no apical meristem family protein [Populus trichocarpa]
Swissprot	tr\|Q8GY42\|NAC25_ARATH	3E-75	NAC transcription factor 25
trEMBL	tr\|B9HYM0\|B9HYM0_POPTR	8E-83	No apical meristem family protein {ECO:0000313\|EMBL:EEE97247.1}
TAIR10	AT1G61110.1	3E-61	NAC domain containing protein 25

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	120987427	120987962	+
GWHAAZE00000001	mRNA	120987427	120987962	+
GWHAAZE00000001	exon	120987427	120987613	+
GWHAAZE00000001	exon	120987721	120987962	+
GWHAAZE00000001	CDS	120987427	120987613	+
GWHAAZE00000001	CDS	120987721	120987962	+

Transcript Sequence
>GWHTAAZE004708 ATGGAGAGCATAGATTCATCGTCGTGTTCGCAGCAGCATCCGAACCTCCCACCGGGCTTTCGCTTCCACCCCACGGATGAAGAGCTGGTAGTTCATTACCTCAAGAAGAAAGTGTCCTCCACCCCTTTACCCGTTACCATCATTGCCGAAATCGATCTCTACAAATTCGATCCATGGGAACTTCCAAGTAAGGCTACGTTTGGCGAACAAGAATGGTATTTCTTCAGTCCGAGGGACCGAAAGTATCCCAACGGAGCTAGGCCTAATCGAGCTGCAACCTCGGGGTACTGGAAAGCCACCGGAACTGACAAGCCGATACTAACGTCAAACGGAACGCAAAAGGTCGGCGTGAAGAAGGCTCTTGTTTTCTACGGCGGAAAGCCCCCAAAGGAATCAAAACTAATTGGATTATGCACGAATATCGACTAG

Network for GWHGAAZE004702

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	17	126	9.60E-34

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.069
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.261
	SRR3591710	White floral bud	125.311
	SRR3591711	White flower	131.601
	SRR3591712	Green floral bud	46.307
	SRR3591713	Yellow flower	111.171
SRP173429	SRR8316895	Juvenile bud stage	15.945
	SRR8316896	Juvenile bud stage	39.959
	SRR8316897	Juvenile bud stage	11.372
	SRR8316894	Third green stage	13.574
	SRR8316900	Third green stage	24.751
	SRR8316901	Third green stage	24.220
	SRR8316898	Complete white stage	75.673
	SRR8316899	Complete white stage	45.051
	SRR8316903	Complete white stage	114.435
	SRR8316902	Silver flowering stage	55.109
	SRR8316904	Silver flowering stage	99.187
	SRR8316905	Silver flowering stage	52.295
	SRR8316906	Gold flowering stage	123.565
	SRR8316907	Gold flowering stage	121.655
	SRR8316908	Gold flowering stage	111.711
SRP132670	SRR6706286	Control	55.885
	SRR6706287	Light intensity 50%	54.572
	SRR6706288	Light intensity 20%	51.509
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.426
	CNS0095593	Slightly white alabastrum(diploid) 2	8.098
	CNS0095594	Slightly white alabastrum(diploid) 3	19.019
	CNS0095595	Whole white alabastrum(diploid) 2	7.838
	CNS0095596	Whole white alabastrum(diploid) 3	12.017
	CNS0095597	Whole white alabastrum(diploid) 4	16.100
	CNS0095598	Silvery flower (diploied) 1	17.947
	CNS0095599	Silvery flower (diploied) 2	17.952
	CNS0095600	Silvery flower (diploied) 3	138.344
	CNS0095601	Golden flower (diploid) 1	16.496
	CNS0095602	Golden flower (diploid) 2	75.229
	CNS0095603	Golden flower (diploid) 3	71.271
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.874
	CNS0095605	Slightly white alabastrum(tetraploid) 2	12.111
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.760
	CNS0095607	Whole white alabastrum(tetraploid) 1	16.133
	CNS0095608	Whole white alabastrum(tetraploid) 2	14.378
	CNS0095609	Whole white alabastrum(tetraploid) 3	33.110
	CNS0095610	Silvery flower (tetraploid) 1	120.643
	CNS0095611	Silvery flower (tetraploid) 2	157.562
	CNS0095612	Silvery flower (tetraploid) 3	192.777
	CNS0095613	Golden flower (tetraploid) 1	55.328
	CNS0095614	Golden flower (tetraploid) 2	102.987
	CNS0095615	Golden flower (tetraploid) 3	81.192
CRA001975	CRR073297	Stem 1	57.123
	CRR073298	Stem 2	64.228
	CRR073299	Stem 3	87.499
	CRR073300	Leaf 1	10.728
	CRR073301	Leaf 2	14.298
	CRR073302	Leaf 3	18.580
	CRR073303	Juvenile bud 1	28.469
	CRR073304	Juvenile bud 2	99.913
	CRR073305	Juvenile bud 3	29.609
	CRR073306	Third green 1	176.972
	CRR073307	Third green 2	133.078
	CRR073308	Third green 3	146.105
	CRR073309	Second white 1	95.266
	CRR073310	Second white 2	172.945
	CRR073311	Second white 3	150.346
	CRR073312	Silver flowering 1	93.127
	CRR073313	Silver flowering 2	68.066
	CRR073314	Silver flowering 3	92.893
	CRR073315	Gold flowering 1	3.620
	CRR073316	Gold flowering 2	8.050
	CRR073317	Gold flowering 3	1.931
	CRR073318	Tawny withering 1	16.886
	CRR073319	Tawny withering 2	6.871
	CRR073320	Tawny withering 3	17.058