Gene detail

Detail information of GWHGAAZE004688

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007144702.1	1.49516E-75	hypothetical protein PHAVU_007G178000g [Phaseolus vulgaris]
Swissprot	tr\|P31674\|RS15_ORYSJ	4E-77	40S ribosomal protein S15
trEMBL	tr\|V7BJF1\|V7BJF1_PHAVU	6E-76	Uncharacterized protein {ECO:0000313\|EMBL:ESW16696.1}
TAIR10	AT5G09500.1	1E-57	Ribosomal protein S19 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	120774305	120774661	+
GWHAAZE00000001	mRNA	120774305	120774661	+
GWHAAZE00000001	exon	120774305	120774661	+
GWHAAZE00000001	CDS	120774305	120774661	+

Transcript Sequence
>GWHTAAZE004694 ATGTCCACTGATGACCTCGTCAAGCTCTTCACTGCCCGTGCTCGCAGAAGGTTTCAGAGGGGTTTGAAGAGGAAGCCCATGGCTTTGATGAAGAAGCTCCGCAAGGCGAAACGGGAGGCTCCAGCAGGTGAGAAGCCAGAGCTCGTGAAGACCCATCTGCGTAATATGATCATAGTACCTGAGATGATCGGAAGCGTTGTTGGAGTCTACAATGGCAAAACTTTCAATCAGATTGAGATCAAGCCTGAAATGATTGGGCACTATTTGGCCGAGTTCTCGATCTCGTACAAACCAGTTAAGCACGGTAGACCTGGTATTGGTGCCACCCACTCTTCGAGGTTCATTCCTCTTAAGTGA

Network for GWHGAAZE004688

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00203.22	Ribosomal_S19	16	101	1.00E-33

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02958	RP-S15e, RPS15	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0015935	cellular_component	small ribosomal subunit
GO:0003723	molecular_function	RNA binding
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	35.060
	SRR3591706	second leaf	13.130
	SRR3591707	mature leaf	8.482
	SRR3591708	Shoot apex	53.125
	SRR3591709	Stem	20.799
	SRR3591710	White floral bud	15.741
	SRR3591711	White flower	22.287
	SRR3591712	Green floral bud	26.088
	SRR3591713	Yellow flower	19.632
SRP173429	SRR8316895	Juvenile bud stage	8.275
	SRR8316896	Juvenile bud stage	9.182
	SRR8316897	Juvenile bud stage	3.787
	SRR8316894	Third green stage	3.415
	SRR8316900	Third green stage	9.631
	SRR8316901	Third green stage	14.603
	SRR8316898	Complete white stage	4.966
	SRR8316899	Complete white stage	12.734
	SRR8316903	Complete white stage	3.863
	SRR8316902	Silver flowering stage	5.794
	SRR8316904	Silver flowering stage	4.144
	SRR8316905	Silver flowering stage	1.328
	SRR8316906	Gold flowering stage	3.156
	SRR8316907	Gold flowering stage	3.231
	SRR8316908	Gold flowering stage	4.755
SRP132670	SRR6706286	Control	3.624
	SRR6706287	Light intensity 50%	4.638
	SRR6706288	Light intensity 20%	3.986
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	15.856
	CNS0095593	Slightly white alabastrum(diploid) 2	19.084
	CNS0095594	Slightly white alabastrum(diploid) 3	17.325
	CNS0095595	Whole white alabastrum(diploid) 2	13.216
	CNS0095596	Whole white alabastrum(diploid) 3	15.016
	CNS0095597	Whole white alabastrum(diploid) 4	8.287
	CNS0095598	Silvery flower (diploied) 1	9.881
	CNS0095599	Silvery flower (diploied) 2	8.055
	CNS0095600	Silvery flower (diploied) 3	5.113
	CNS0095601	Golden flower (diploid) 1	6.472
	CNS0095602	Golden flower (diploid) 2	6.147
	CNS0095603	Golden flower (diploid) 3	5.439
	CNS0095604	Slightly white alabastrum(tetraploid) 1	14.966
	CNS0095605	Slightly white alabastrum(tetraploid) 2	13.481
	CNS0095606	Slightly white alabastrum(tetraploid) 3	24.745
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.615
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.983
	CNS0095609	Whole white alabastrum(tetraploid) 3	11.603
	CNS0095610	Silvery flower (tetraploid) 1	7.486
	CNS0095611	Silvery flower (tetraploid) 2	3.693
	CNS0095612	Silvery flower (tetraploid) 3	3.782
	CNS0095613	Golden flower (tetraploid) 1	8.373
	CNS0095614	Golden flower (tetraploid) 2	7.430
	CNS0095615	Golden flower (tetraploid) 3	4.632
CRA001975	CRR073297	Stem 1	7.965
	CRR073298	Stem 2	11.077
	CRR073299	Stem 3	10.601
	CRR073300	Leaf 1	7.194
	CRR073301	Leaf 2	8.532
	CRR073302	Leaf 3	8.006
	CRR073303	Juvenile bud 1	8.948
	CRR073304	Juvenile bud 2	4.663
	CRR073305	Juvenile bud 3	6.161
	CRR073306	Third green 1	2.615
	CRR073307	Third green 2	2.300
	CRR073308	Third green 3	3.863
	CRR073309	Second white 1	3.122
	CRR073310	Second white 2	3.173
	CRR073311	Second white 3	1.861
	CRR073312	Silver flowering 1	3.297
	CRR073313	Silver flowering 2	5.314
	CRR073314	Silver flowering 3	4.936
	CRR073315	Gold flowering 1	7.124
	CRR073316	Gold flowering 2	5.757
	CRR073317	Gold flowering 3	8.003
	CRR073318	Tawny withering 1	10.303
	CRR073319	Tawny withering 2	11.609
	CRR073320	Tawny withering 3	13.614