Gene detail

Detail information of GWHGAAZE004652

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002279760.1	6.95527E-67	PREDICTED: ethylene-responsive transcription factor 12 [Vitis vinifera]
Swissprot	tr\|Q94ID6\|ERF81_ARATH	1E-46	Ethylene-responsive transcription factor 12
trEMBL	tr\|F6HM27\|F6HM27_VITVI	3E-67	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB55615.1}
TAIR10	AT1G28360.1	5E-38	ERF domain protein 12

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	120231068	120231526	-
GWHAAZE00000001	mRNA	120231068	120231526	-
GWHAAZE00000001	exon	120231068	120231526	-
GWHAAZE00000001	CDS	120231068	120231526	-

Transcript Sequence
>GWHTAAZE004658 ATGGCATCATCATCCACTAGAGAAGGCCATTACAGAGGAGTGAGAAAGAGACCATGGGGTCGTTACGCAGCTGAAATACGTGACCCTTGGAAGAAAACTCGTGTTTGGTTGGGCACTTTTGATACTCCGGAGGAAGCCGCCATGGCTTACGACGGCGCTGCTCGTAACCTACGAGGTGCTAAAGCTAAAACTAACTTCCCGGCGCCTCCGACACCGCTGTCTCTTGACCTCAACAATCTTCCTTCCGACCACCGGTGGCAGCTCCCTTCTGGCCGGTCAATCTTCGGAGAATTCCTTCGTACCGGTGTTTTGAAAGACGTGGCTGACTCAGCCGTCAACAATGACCGTGCCGGAGTTATTTCTGGGGAGGTTCCGGTGCCGGAGAATTCGATCCAGACGGCGTATTTTAGACGTGGGTTGCCGATTGATTTGAACGAGCCTCCACCACTTTGGCTGTGA

Network for GWHGAAZE004652

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	10	59	1.00E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	5.270
	SRR3591706	second leaf	3.435
	SRR3591707	mature leaf	3.612
	SRR3591708	Shoot apex	8.494
	SRR3591709	Stem	23.778
	SRR3591710	White floral bud	1.122
	SRR3591711	White flower	8.974
	SRR3591712	Green floral bud	4.375
	SRR3591713	Yellow flower	9.457
SRP173429	SRR8316895	Juvenile bud stage	6.680
	SRR8316896	Juvenile bud stage	5.617
	SRR8316897	Juvenile bud stage	1.517
	SRR8316894	Third green stage	0.566
	SRR8316900	Third green stage	0.839
	SRR8316901	Third green stage	0.776
	SRR8316898	Complete white stage	0.287
	SRR8316899	Complete white stage	5.985
	SRR8316903	Complete white stage	0.770
	SRR8316902	Silver flowering stage	3.074
	SRR8316904	Silver flowering stage	0.798
	SRR8316905	Silver flowering stage	0.221
	SRR8316906	Gold flowering stage	0.905
	SRR8316907	Gold flowering stage	4.080
	SRR8316908	Gold flowering stage	4.453
SRP132670	SRR6706286	Control	2.514
	SRR6706287	Light intensity 50%	2.613
	SRR6706288	Light intensity 20%	2.910
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.103
	CNS0095593	Slightly white alabastrum(diploid) 2	9.166
	CNS0095594	Slightly white alabastrum(diploid) 3	6.829
	CNS0095595	Whole white alabastrum(diploid) 2	4.336
	CNS0095596	Whole white alabastrum(diploid) 3	1.323
	CNS0095597	Whole white alabastrum(diploid) 4	3.107
	CNS0095598	Silvery flower (diploied) 1	12.620
	CNS0095599	Silvery flower (diploied) 2	4.120
	CNS0095600	Silvery flower (diploied) 3	3.199
	CNS0095601	Golden flower (diploid) 1	10.556
	CNS0095602	Golden flower (diploid) 2	7.031
	CNS0095603	Golden flower (diploid) 3	6.579
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.427
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.626
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.087
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.766
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.715
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.922
	CNS0095610	Silvery flower (tetraploid) 1	2.132
	CNS0095611	Silvery flower (tetraploid) 2	1.640
	CNS0095612	Silvery flower (tetraploid) 3	1.614
	CNS0095613	Golden flower (tetraploid) 1	2.330
	CNS0095614	Golden flower (tetraploid) 2	8.883
	CNS0095615	Golden flower (tetraploid) 3	0.504
CRA001975	CRR073297	Stem 1	40.733
	CRR073298	Stem 2	31.851
	CRR073299	Stem 3	62.632
	CRR073300	Leaf 1	5.399
	CRR073301	Leaf 2	12.677
	CRR073302	Leaf 3	10.071
	CRR073303	Juvenile bud 1	8.616
	CRR073304	Juvenile bud 2	2.756
	CRR073305	Juvenile bud 3	13.377
	CRR073306	Third green 1	15.206
	CRR073307	Third green 2	11.246
	CRR073308	Third green 3	10.338
	CRR073309	Second white 1	9.339
	CRR073310	Second white 2	7.065
	CRR073311	Second white 3	5.750
	CRR073312	Silver flowering 1	7.673
	CRR073313	Silver flowering 2	15.520
	CRR073314	Silver flowering 3	10.563
	CRR073315	Gold flowering 1	133.206
	CRR073316	Gold flowering 2	120.258
	CRR073317	Gold flowering 3	95.924
	CRR073318	Tawny withering 1	117.834
	CRR073319	Tawny withering 2	76.636
	CRR073320	Tawny withering 3	163.071