Gene detail

Detail information of GWHGAAZE004651

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ABK96798.1	5.53276E-43	ethylene response factor 3 [Solanum tuberosum]
Swissprot	tr\|Q9FE67\|ERF80_ARATH	5E-33	Ethylene-responsive transcription factor 9
trEMBL	tr\|A1E0X9\|A1E0X9_SOLTU	2E-43	Ethylene response factor 3 {ECO:0000313\|EMBL:ABK96798.1}
TAIR10	AT1G28370.1	1E-21	ERF domain protein 11

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	120224235	120224846	+
GWHAAZE00000001	mRNA	120224235	120224846	+
GWHAAZE00000001	exon	120224235	120224522	+
GWHAAZE00000001	exon	120224625	120224846	+
GWHAAZE00000001	CDS	120224235	120224522	+
GWHAAZE00000001	CDS	120224625	120224846	+

Transcript Sequence
>GWHTAAZE004657 ATGGCGCCTGTGGTTGGCGGAGCTGGTAAGGATGTGCGTTTTAGAGGCGTACGGAAGAGGCCGTGGGGAAGATACGCGGCCGAGATCCGTGACCCCGGTAAAAAAAGCCGCGTGTGGCTGGGGACATTCGACACGGCGGAGGAGGCTGCGATGGCCTACGACGCTGCCGCTAGAAAGTTTCGCGGCGACAAAGCAAAGACTAATTTTTCATTCCCCGAGGAAATCATCAGGATCGATAATCAGATTCAGAGTCCTAGCCAGGGCAGTATAGTAGAGTCCTTGGCTCCGACCATCAACGGCGGTGTTTTTCCGGTGAACGACCGTACGTTTTATTTTGATGAGATTTCCCGGCGAGGGATTATTAATCAGAGCTATAATAGGAGCGACTGGAACTCGTCTTCGGTTATTGACTTAAAACCTAACGTAGCTAAGATGCATCACAAAAGACTTGATTTGGATCTAAATTATCCACCGCCGGAGTTTTACGAGGACGATTTCCGGCGAGGATAG

Network for GWHGAAZE004651

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	13	62	4.00E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.326
	SRR3591706	second leaf	1.127
	SRR3591707	mature leaf	1.442
	SRR3591708	Shoot apex	0.926
	SRR3591709	Stem	8.765
	SRR3591710	White floral bud	2.518
	SRR3591711	White flower	8.938
	SRR3591712	Green floral bud	3.520
	SRR3591713	Yellow flower	9.823
SRP173429	SRR8316895	Juvenile bud stage	3.876
	SRR8316896	Juvenile bud stage	1.774
	SRR8316897	Juvenile bud stage	1.001
	SRR8316894	Third green stage	0.962
	SRR8316900	Third green stage	0.643
	SRR8316901	Third green stage	1.842
	SRR8316898	Complete white stage	0.523
	SRR8316899	Complete white stage	5.353
	SRR8316903	Complete white stage	0.818
	SRR8316902	Silver flowering stage	2.886
	SRR8316904	Silver flowering stage	0.789
	SRR8316905	Silver flowering stage	0.383
	SRR8316906	Gold flowering stage	1.421
	SRR8316907	Gold flowering stage	3.162
	SRR8316908	Gold flowering stage	1.537
SRP132670	SRR6706286	Control	2.936
	SRR6706287	Light intensity 50%	3.150
	SRR6706288	Light intensity 20%	3.376
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.736
	CNS0095593	Slightly white alabastrum(diploid) 2	10.592
	CNS0095594	Slightly white alabastrum(diploid) 3	8.966
	CNS0095595	Whole white alabastrum(diploid) 2	5.112
	CNS0095596	Whole white alabastrum(diploid) 3	3.062
	CNS0095597	Whole white alabastrum(diploid) 4	3.515
	CNS0095598	Silvery flower (diploied) 1	12.330
	CNS0095599	Silvery flower (diploied) 2	7.565
	CNS0095600	Silvery flower (diploied) 3	6.220
	CNS0095601	Golden flower (diploid) 1	7.381
	CNS0095602	Golden flower (diploid) 2	9.502
	CNS0095603	Golden flower (diploid) 3	9.369
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.642
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.743
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.613
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.965
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.705
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.010
	CNS0095610	Silvery flower (tetraploid) 1	3.283
	CNS0095611	Silvery flower (tetraploid) 2	1.194
	CNS0095612	Silvery flower (tetraploid) 3	3.704
	CNS0095613	Golden flower (tetraploid) 1	2.000
	CNS0095614	Golden flower (tetraploid) 2	4.832
	CNS0095615	Golden flower (tetraploid) 3	0.792
CRA001975	CRR073297	Stem 1	8.156
	CRR073298	Stem 2	5.461
	CRR073299	Stem 3	10.257
	CRR073300	Leaf 1	4.269
	CRR073301	Leaf 2	5.535
	CRR073302	Leaf 3	4.405
	CRR073303	Juvenile bud 1	3.151
	CRR073304	Juvenile bud 2	1.957
	CRR073305	Juvenile bud 3	7.108
	CRR073306	Third green 1	8.428
	CRR073307	Third green 2	12.623
	CRR073308	Third green 3	9.520
	CRR073309	Second white 1	4.539
	CRR073310	Second white 2	8.363
	CRR073311	Second white 3	7.091
	CRR073312	Silver flowering 1	3.593
	CRR073313	Silver flowering 2	3.547
	CRR073314	Silver flowering 3	4.691
	CRR073315	Gold flowering 1	12.524
	CRR073316	Gold flowering 2	10.902
	CRR073317	Gold flowering 3	6.795
	CRR073318	Tawny withering 1	16.659
	CRR073319	Tawny withering 2	25.619
	CRR073320	Tawny withering 3	23.320