Gene detail

Detail information of GWHGAAZE004596

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007025416.1	3.24729E-39	50S ribosomal protein L34 [Theobroma cacao]
Swissprot	tr\|P82244\|RK34_SPIOL	5E-30	50S ribosomal protein L34, chloroplastic (Precursor)
trEMBL	tr\|A0A061GF34\|A0A061GF34_THECC	1E-39	Ribosomal protein L34 {ECO:0000256\|RuleBase:RU000566}
TAIR10	AT1G29070.1	3E-16	Ribosomal protein L34

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	119421027	119421284	-
GWHAAZE00000001	mRNA	119421027	119421284	-
GWHAAZE00000001	exon	119421027	119421284	-
GWHAAZE00000001	CDS	119421027	119421284	-

Transcript Sequence
>GWHTAAZE004602 GGCTTGTCCTTGGGGTTAGACTTCAACACTTGCAATGGGACAAGAACAACTAAACGCCATGGTCTAGTGGTGAGGGCAGGGAAGGCTGCTCTTTGCCTAACGAAGAGGAACAGGTCCCGCAAGTCTCTGGCTCGTACTCATGGCTTCCGCAAAAGAATGAGAACCACTGGTGGAAGAGCAATATTGAAGCGCAGGCGTGCCAAGGGCCGAAAGGCGCTTTGCACCAAGACCAACCACAATACTGGAAAACGTTCTTGA

Network for GWHGAAZE004596

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00468.18	Ribosomal_L34	39	74	1.80E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02914	RP-L34, MRPL34, rpmH	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	104.756
	SRR3591706	second leaf	229.990
	SRR3591707	mature leaf	125.183
	SRR3591708	Shoot apex	234.072
	SRR3591709	Stem	41.023
	SRR3591710	White floral bud	42.443
	SRR3591711	White flower	60.447
	SRR3591712	Green floral bud	97.774
	SRR3591713	Yellow flower	81.505
SRP173429	SRR8316895	Juvenile bud stage	76.851
	SRR8316896	Juvenile bud stage	72.944
	SRR8316897	Juvenile bud stage	59.316
	SRR8316894	Third green stage	39.082
	SRR8316900	Third green stage	140.451
	SRR8316901	Third green stage	118.181
	SRR8316898	Complete white stage	22.044
	SRR8316899	Complete white stage	67.144
	SRR8316903	Complete white stage	30.521
	SRR8316902	Silver flowering stage	20.983
	SRR8316904	Silver flowering stage	26.044
	SRR8316905	Silver flowering stage	16.102
	SRR8316906	Gold flowering stage	62.046
	SRR8316907	Gold flowering stage	72.627
	SRR8316908	Gold flowering stage	38.280
SRP132670	SRR6706286	Control	84.345
	SRR6706287	Light intensity 50%	88.624
	SRR6706288	Light intensity 20%	100.851
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	78.451
	CNS0095593	Slightly white alabastrum(diploid) 2	61.592
	CNS0095594	Slightly white alabastrum(diploid) 3	47.766
	CNS0095595	Whole white alabastrum(diploid) 2	65.586
	CNS0095596	Whole white alabastrum(diploid) 3	82.432
	CNS0095597	Whole white alabastrum(diploid) 4	70.408
	CNS0095598	Silvery flower (diploied) 1	75.883
	CNS0095599	Silvery flower (diploied) 2	55.708
	CNS0095600	Silvery flower (diploied) 3	58.284
	CNS0095601	Golden flower (diploid) 1	56.798
	CNS0095602	Golden flower (diploid) 2	85.520
	CNS0095603	Golden flower (diploid) 3	87.363
	CNS0095604	Slightly white alabastrum(tetraploid) 1	75.953
	CNS0095605	Slightly white alabastrum(tetraploid) 2	79.564
	CNS0095606	Slightly white alabastrum(tetraploid) 3	83.841
	CNS0095607	Whole white alabastrum(tetraploid) 1	35.253
	CNS0095608	Whole white alabastrum(tetraploid) 2	51.588
	CNS0095609	Whole white alabastrum(tetraploid) 3	108.299
	CNS0095610	Silvery flower (tetraploid) 1	41.503
	CNS0095611	Silvery flower (tetraploid) 2	52.765
	CNS0095612	Silvery flower (tetraploid) 3	52.328
	CNS0095613	Golden flower (tetraploid) 1	58.691
	CNS0095614	Golden flower (tetraploid) 2	56.082
	CNS0095615	Golden flower (tetraploid) 3	57.699
CRA001975	CRR073297	Stem 1	118.654
	CRR073298	Stem 2	111.318
	CRR073299	Stem 3	141.910
	CRR073300	Leaf 1	83.421
	CRR073301	Leaf 2	89.119
	CRR073302	Leaf 3	120.763
	CRR073303	Juvenile bud 1	109.019
	CRR073304	Juvenile bud 2	114.693
	CRR073305	Juvenile bud 3	74.604
	CRR073306	Third green 1	36.878
	CRR073307	Third green 2	33.739
	CRR073308	Third green 3	30.958
	CRR073309	Second white 1	66.000
	CRR073310	Second white 2	41.799
	CRR073311	Second white 3	36.371
	CRR073312	Silver flowering 1	39.458
	CRR073313	Silver flowering 2	44.507
	CRR073314	Silver flowering 3	52.426
	CRR073315	Gold flowering 1	240.073
	CRR073316	Gold flowering 2	253.378
	CRR073317	Gold flowering 3	172.685
	CRR073318	Tawny withering 1	49.529
	CRR073319	Tawny withering 2	45.038
	CRR073320	Tawny withering 3	49.914