Gene detail

Detail information of GWHGAAZE004536

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002519717.1	6.08015E-51	mitochondrial inner membrane protease subunit, putative [Ricinus communis]
COG	YP_003826149.1	0.00000006	signal peptidase I
trEMBL	tr\|B9S148\|B9S148_RICCO	2E-51	Mitochondrial inner membrane protease subunit, putative {ECO:0000313\|EMBL:EEF42690.1}
TAIR10	AT1G53530.1	5E-30	Peptidase S24/S26A/S26B/S26C family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	118506337	118506767	+
GWHAAZE00000001	mRNA	118506337	118506767	+
GWHAAZE00000001	exon	118506337	118506453	+
GWHAAZE00000001	exon	118506537	118506767	+
GWHAAZE00000001	CDS	118506337	118506453	+
GWHAAZE00000001	CDS	118506537	118506767	+

Transcript Sequence
>GWHTAAZE004542 ATGAATTTGCAGGTATGGAGTAAAATACTCAAGGAAGCATTCCATAAAAGTTTACCTTTCGCAAAATTCTTATGTTATCTTCACGTCACCAACACCTACCTCTTCACCACTGCTCTAGTTTATGGTCCGAGCATGCTCCCAACCTTCGATATCACCGGGGATTTTGTATTGGCGGAGCGAATGTCGGTCCGATTTGGCAAAGTGCGAAAAGGGGACGTTGTTCTGGTCAGGTCACCTATAAACCCTAGGAAAATTGTCACTAAACGAGTAACGGGCATGGAAGGTGATAGTATCACTTATGTTGTGGACCCCAAGAACAGTGATCGCCAAGAGACTCTTGTTGTATGA

Network for GWHGAAZE004536

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF10502.10	Peptidase_S26	24	100	1.10E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K09647	IMP1	Protein export	map03060

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0016020	cellular_component	membrane
GO:0008236	molecular_function	serine-type peptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	38.073
	SRR3591706	second leaf	18.911
	SRR3591707	mature leaf	9.659
	SRR3591708	Shoot apex	37.305
	SRR3591709	Stem	33.757
	SRR3591710	White floral bud	35.047
	SRR3591711	White flower	36.506
	SRR3591712	Green floral bud	25.587
	SRR3591713	Yellow flower	31.832
SRP173429	SRR8316895	Juvenile bud stage	21.975
	SRR8316896	Juvenile bud stage	30.079
	SRR8316897	Juvenile bud stage	17.220
	SRR8316894	Third green stage	11.313
	SRR8316900	Third green stage	34.604
	SRR8316901	Third green stage	34.617
	SRR8316898	Complete white stage	19.131
	SRR8316899	Complete white stage	36.793
	SRR8316903	Complete white stage	32.692
	SRR8316902	Silver flowering stage	17.392
	SRR8316904	Silver flowering stage	31.077
	SRR8316905	Silver flowering stage	9.870
	SRR8316906	Gold flowering stage	35.323
	SRR8316907	Gold flowering stage	31.838
	SRR8316908	Gold flowering stage	38.715
SRP132670	SRR6706286	Control	46.643
	SRR6706287	Light intensity 50%	47.048
	SRR6706288	Light intensity 20%	50.995
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	34.507
	CNS0095593	Slightly white alabastrum(diploid) 2	37.223
	CNS0095594	Slightly white alabastrum(diploid) 3	35.669
	CNS0095595	Whole white alabastrum(diploid) 2	26.890
	CNS0095596	Whole white alabastrum(diploid) 3	27.869
	CNS0095597	Whole white alabastrum(diploid) 4	22.449
	CNS0095598	Silvery flower (diploied) 1	31.862
	CNS0095599	Silvery flower (diploied) 2	21.973
	CNS0095600	Silvery flower (diploied) 3	36.693
	CNS0095601	Golden flower (diploid) 1	28.379
	CNS0095602	Golden flower (diploid) 2	27.212
	CNS0095603	Golden flower (diploid) 3	28.675
	CNS0095604	Slightly white alabastrum(tetraploid) 1	29.843
	CNS0095605	Slightly white alabastrum(tetraploid) 2	30.109
	CNS0095606	Slightly white alabastrum(tetraploid) 3	40.460
	CNS0095607	Whole white alabastrum(tetraploid) 1	21.579
	CNS0095608	Whole white alabastrum(tetraploid) 2	19.771
	CNS0095609	Whole white alabastrum(tetraploid) 3	25.074
	CNS0095610	Silvery flower (tetraploid) 1	38.869
	CNS0095611	Silvery flower (tetraploid) 2	35.744
	CNS0095612	Silvery flower (tetraploid) 3	84.041
	CNS0095613	Golden flower (tetraploid) 1	38.068
	CNS0095614	Golden flower (tetraploid) 2	37.160
	CNS0095615	Golden flower (tetraploid) 3	33.543
CRA001975	CRR073297	Stem 1	29.405
	CRR073298	Stem 2	26.454
	CRR073299	Stem 3	21.260
	CRR073300	Leaf 1	34.128
	CRR073301	Leaf 2	31.871
	CRR073302	Leaf 3	23.615
	CRR073303	Juvenile bud 1	19.761
	CRR073304	Juvenile bud 2	19.575
	CRR073305	Juvenile bud 3	18.323
	CRR073306	Third green 1	17.657
	CRR073307	Third green 2	20.978
	CRR073308	Third green 3	23.437
	CRR073309	Second white 1	17.293
	CRR073310	Second white 2	18.946
	CRR073311	Second white 3	13.405
	CRR073312	Silver flowering 1	14.307
	CRR073313	Silver flowering 2	16.153
	CRR073314	Silver flowering 3	15.769
	CRR073315	Gold flowering 1	6.166
	CRR073316	Gold flowering 2	10.633
	CRR073317	Gold flowering 3	4.609
	CRR073318	Tawny withering 1	22.784
	CRR073319	Tawny withering 2	17.868
	CRR073320	Tawny withering 3	19.962