Gene detail

Detail information of GWHGAAZE004481

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008358195.1	2.8422E-161	PREDICTED: chlorophyll a-b binding protein of LHCII type 1-like [Malus domestica]
Swissprot	tr\|P27493\|CB22_TOBAC	2E-162	Chlorophyll a-b binding protein 21, chloroplastic (Precursor)
trEMBL	tr\|A0A059CBZ6\|A0A059CBZ6_EUCGR	1E-161	Uncharacterized protein {ECO:0000313\|EMBL:KCW75953.1}
TAIR10	AT1G29930.1	2E-116	chlorophyll A/B binding protein 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	117851870	117852565	+
GWHAAZE00000001	mRNA	117851870	117852565	+
GWHAAZE00000001	exon	117851870	117852565	+
GWHAAZE00000001	CDS	117851870	117852565	+

Transcript Sequence
>GWHTAAZE004487 ATGAGAAAAAGTGCCAAAAAGCCAGCCTCATCCGACAGCCCATGGTATGGCCCAGACCGAGTCAAGTATTTGGGTCCATTCTCCGGTGAGGCTCCATCTTACCTCACTGGTGAATTCCCAGGTGACTATGGTTGGGACACTGCTGGACTTTCAGCAGACCCAGAAACCTTTGCCAAGAACCGTGAACTCGAGGTAATCCATTGCAGATGGGCCATGCTTGGAGCTCTTGGGTGCGTCTTCCCTGAGCTTTTGTCCCGCAATGGCGTCAAGTTCGGTGAAGCTGTATGGTTCAAGGCCGGAGCCCAAATCTTTAGTGAGGGTGGACTTGACTACTTGGGTAACCCGAGCTTGGTCCATGCTCAAAGTATCTTGGCCATTTGGGCTACACAAGTTATATTGATGGGAGCTATTGAGGGTTATCGTGTTGCCGGTGGGCCACTTGGTGAGGTTACTGATCCACTTTATCCAGGTGGAAGCTTTGACCCATTAGGCCTTGCTGATGATCCCGAGGCTTTTGCAGAGCTTAAGGTGAAGGAGATCAAGAATGGAAGATTGGCCATGTTCTCCATGTTTGGGTTCTTTGTGCAGGCTATTGTGACCGGAAAAGGACCATTGGAGAACCTTGCTGACCATCTGGCTGACCCTGTTAGCAACAATGCTTGGGCATATGCAACAAACTTTGTCCCCGGAAAGTGA

Network for GWHGAAZE004481

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00504.22	Chloroa_b-bind	31	197	8.80E-51

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08912	LHCB1	Metabolic pathways	map01100
K08912	LHCB1	Photosynthesis - antenna proteins	map00196

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	624.693
	SRR3591706	second leaf	6976.440
	SRR3591707	mature leaf	5362.744
	SRR3591708	Shoot apex	2375.054
	SRR3591709	Stem	479.298
	SRR3591710	White floral bud	24.944
	SRR3591711	White flower	78.891
	SRR3591712	Green floral bud	38.886
	SRR3591713	Yellow flower	31.274
SRP173429	SRR8316895	Juvenile bud stage	134.643
	SRR8316896	Juvenile bud stage	92.424
	SRR8316897	Juvenile bud stage	84.778
	SRR8316894	Third green stage	31.039
	SRR8316900	Third green stage	34.280
	SRR8316901	Third green stage	44.761
	SRR8316898	Complete white stage	8.346
	SRR8316899	Complete white stage	23.531
	SRR8316903	Complete white stage	28.795
	SRR8316902	Silver flowering stage	3.508
	SRR8316904	Silver flowering stage	5.270
	SRR8316905	Silver flowering stage	2.008
	SRR8316906	Gold flowering stage	8.908
	SRR8316907	Gold flowering stage	12.113
	SRR8316908	Gold flowering stage	16.743
SRP132670	SRR6706286	Control	63.202
	SRR6706287	Light intensity 50%	33.734
	SRR6706288	Light intensity 20%	28.108
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	98.598
	CNS0095593	Slightly white alabastrum(diploid) 2	62.603
	CNS0095594	Slightly white alabastrum(diploid) 3	97.899
	CNS0095595	Whole white alabastrum(diploid) 2	47.576
	CNS0095596	Whole white alabastrum(diploid) 3	36.456
	CNS0095597	Whole white alabastrum(diploid) 4	41.821
	CNS0095598	Silvery flower (diploied) 1	584.056
	CNS0095599	Silvery flower (diploied) 2	474.801
	CNS0095600	Silvery flower (diploied) 3	99.267
	CNS0095601	Golden flower (diploid) 1	450.957
	CNS0095602	Golden flower (diploid) 2	303.850
	CNS0095603	Golden flower (diploid) 3	295.543
	CNS0095604	Slightly white alabastrum(tetraploid) 1	67.447
	CNS0095605	Slightly white alabastrum(tetraploid) 2	82.902
	CNS0095606	Slightly white alabastrum(tetraploid) 3	111.973
	CNS0095607	Whole white alabastrum(tetraploid) 1	48.514
	CNS0095608	Whole white alabastrum(tetraploid) 2	21.705
	CNS0095609	Whole white alabastrum(tetraploid) 3	35.593
	CNS0095610	Silvery flower (tetraploid) 1	108.328
	CNS0095611	Silvery flower (tetraploid) 2	212.398
	CNS0095612	Silvery flower (tetraploid) 3	37.309
	CNS0095613	Golden flower (tetraploid) 1	109.133
	CNS0095614	Golden flower (tetraploid) 2	143.170
	CNS0095615	Golden flower (tetraploid) 3	38.589
CRA001975	CRR073297	Stem 1	44.030
	CRR073298	Stem 2	28.992
	CRR073299	Stem 3	91.376
	CRR073300	Leaf 1	1.425
	CRR073301	Leaf 2	7.688
	CRR073302	Leaf 3	5.202
	CRR073303	Juvenile bud 1	3.436
	CRR073304	Juvenile bud 2	6.618
	CRR073305	Juvenile bud 3	9.081
	CRR073306	Third green 1	4.535
	CRR073307	Third green 2	1.858
	CRR073308	Third green 3	4.692
	CRR073309	Second white 1	2.057
	CRR073310	Second white 2	2.466
	CRR073311	Second white 3	7.019
	CRR073312	Silver flowering 1	17.731
	CRR073313	Silver flowering 2	23.897
	CRR073314	Silver flowering 3	18.215
	CRR073315	Gold flowering 1	505.484
	CRR073316	Gold flowering 2	352.800
	CRR073317	Gold flowering 3	415.976
	CRR073318	Tawny withering 1	67.144
	CRR073319	Tawny withering 2	62.010
	CRR073320	Tawny withering 3	37.167