Gene detail

Detail information of GWHGAAZE004454

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009365285.1	1.4098E-101	PREDICTED: 60S ribosomal protein L11 isoform X1 [Pyrus x bretschneideri]
COG	YP_003435583.1	2E-37	50S ribosomal protein L5
Swissprot	tr\|P46287\|RL11_MEDSA	2E-102	60S ribosomal protein L11
trEMBL	tr\|W1PXF8\|W1PXF8_AMBTC	1E-101	Uncharacterized protein {ECO:0000313\|EMBL:ERN12546.1}
TAIR10	AT2G42740.1	3E-68	ribosomal protein large subunit 16A

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	117436758	117438375	+
GWHAAZE00000001	mRNA	117436758	117438375	+
GWHAAZE00000001	exon	117436758	117436800	+
GWHAAZE00000001	exon	117436891	117437086	+
GWHAAZE00000001	exon	117438177	117438375	+
GWHAAZE00000001	CDS	117436758	117436800	+
GWHAAZE00000001	CDS	117436891	117437086	+
GWHAAZE00000001	CDS	117438177	117438375	+

Transcript Sequence
>GWHTAAZE004460 GTTTTGGAGCAATTGAGTGGGCAAACCCCTGTATTCTCCAAGGCGAGGTACACTGTGCGATCCTTTGGAATCAGGAGAAACGAGAAAATTGCATGCTATGTCACAGTTAGGGGAGACAAGGCTATGCAGCTTCTTGAGAGTGGCTTGAAGGTTAAGGAGTATGAACTTTTGAGGCGCAACTTCAGTGATACTGGCTGTTTTGGGTTTGGTATTCAGGAGCACATCGATCTTGGTATCAAGTACGATCCATCAACGGGTATTTATGGGATGGACTTCTATGTGGTGCTAGAACGGCCAGGGTACCGTGTGGGAAGACGCCGTAGGTGCAAAGCCCGTGTCGGTATCCAGCACAGAGTTACAAAGGATGATGCAATGAAATGGTTCCAGGTCAAATACGAGGGTGTGATCCTCAACAAGTCCCAACAAATTGGAGCTTAA

Network for GWHGAAZE004454

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00673.22	Ribosomal_L5_C	29	127	8.60E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02868	RP-L11e, RPL11	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	151.924
	SRR3591706	second leaf	80.455
	SRR3591707	mature leaf	40.165
	SRR3591708	Shoot apex	173.326
	SRR3591709	Stem	90.833
	SRR3591710	White floral bud	66.695
	SRR3591711	White flower	83.247
	SRR3591712	Green floral bud	105.521
	SRR3591713	Yellow flower	76.162
SRP173429	SRR8316895	Juvenile bud stage	81.607
	SRR8316896	Juvenile bud stage	114.472
	SRR8316897	Juvenile bud stage	71.112
	SRR8316894	Third green stage	46.494
	SRR8316900	Third green stage	154.099
	SRR8316901	Third green stage	141.869
	SRR8316898	Complete white stage	30.356
	SRR8316899	Complete white stage	157.824
	SRR8316903	Complete white stage	51.676
	SRR8316902	Silver flowering stage	36.916
	SRR8316904	Silver flowering stage	37.819
	SRR8316905	Silver flowering stage	20.826
	SRR8316906	Gold flowering stage	55.701
	SRR8316907	Gold flowering stage	61.154
	SRR8316908	Gold flowering stage	68.689
SRP132670	SRR6706286	Control	184.424
	SRR6706287	Light intensity 50%	186.306
	SRR6706288	Light intensity 20%	202.371
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	172.275
	CNS0095593	Slightly white alabastrum(diploid) 2	209.958
	CNS0095594	Slightly white alabastrum(diploid) 3	165.721
	CNS0095595	Whole white alabastrum(diploid) 2	149.271
	CNS0095596	Whole white alabastrum(diploid) 3	183.540
	CNS0095597	Whole white alabastrum(diploid) 4	109.861
	CNS0095598	Silvery flower (diploied) 1	105.426
	CNS0095599	Silvery flower (diploied) 2	96.150
	CNS0095600	Silvery flower (diploied) 3	85.663
	CNS0095601	Golden flower (diploid) 1	110.651
	CNS0095602	Golden flower (diploid) 2	82.369
	CNS0095603	Golden flower (diploid) 3	81.134
	CNS0095604	Slightly white alabastrum(tetraploid) 1	169.852
	CNS0095605	Slightly white alabastrum(tetraploid) 2	179.453
	CNS0095606	Slightly white alabastrum(tetraploid) 3	201.505
	CNS0095607	Whole white alabastrum(tetraploid) 1	97.626
	CNS0095608	Whole white alabastrum(tetraploid) 2	88.805
	CNS0095609	Whole white alabastrum(tetraploid) 3	163.244
	CNS0095610	Silvery flower (tetraploid) 1	85.770
	CNS0095611	Silvery flower (tetraploid) 2	99.794
	CNS0095612	Silvery flower (tetraploid) 3	63.259
	CNS0095613	Golden flower (tetraploid) 1	74.203
	CNS0095614	Golden flower (tetraploid) 2	88.355
	CNS0095615	Golden flower (tetraploid) 3	53.766
CRA001975	CRR073297	Stem 1	138.970
	CRR073298	Stem 2	140.132
	CRR073299	Stem 3	135.220
	CRR073300	Leaf 1	147.111
	CRR073301	Leaf 2	156.879
	CRR073302	Leaf 3	173.696
	CRR073303	Juvenile bud 1	150.085
	CRR073304	Juvenile bud 2	87.944
	CRR073305	Juvenile bud 3	126.130
	CRR073306	Third green 1	25.689
	CRR073307	Third green 2	31.117
	CRR073308	Third green 3	26.502
	CRR073309	Second white 1	29.246
	CRR073310	Second white 2	22.562
	CRR073311	Second white 3	21.188
	CRR073312	Silver flowering 1	27.793
	CRR073313	Silver flowering 2	32.429
	CRR073314	Silver flowering 3	27.194
	CRR073315	Gold flowering 1	38.885
	CRR073316	Gold flowering 2	37.794
	CRR073317	Gold flowering 3	41.301
	CRR073318	Tawny withering 1	120.134
	CRR073319	Tawny withering 2	99.454
	CRR073320	Tawny withering 3	130.728