Gene detail

Detail information of GWHGAAZE004378

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	DAA51373.1	3.54414E-91	TPA: hypothetical protein ZEAMMB73_041268 [Zea mays]
Swissprot	tr\|Q40665\|TBB3_ORYSJ	8E-91	Tubulin beta-3 chain
trEMBL	tr\|A0A096RK53\|A0A096RK53_MAIZE	1E-91	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GRMZM2G099944_P02}
TAIR10	AT5G62700.1	7E-74	tubulin beta chain 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	116076173	116076604	+
GWHAAZE00000001	mRNA	116076173	116076604	+
GWHAAZE00000001	exon	116076173	116076604	+
GWHAAZE00000001	CDS	116076173	116076604	+

Transcript Sequence
>GWHTAAZE004384 ATGAGAGAAATCCTCCACATCCAAGGCGGCCAATGCGGCAACCAAATCGGAGCCAAGTTCTGGGAAGTCATCTGTTCCGAGCACGGCATAGATCCCACCGGCAAGTACTCCGGCGACTCCGATCTACAACTCGAGCGCATCAATGTCTACTATAACGAGGCGAGTGGTGGCCGATACGTGCCACGTGCTGTTCTCATGGACCTTGAGCCTGGTACTATGGATTCTTTGCGATCGGGTCCTTTTGGCCAGATCTTTCGACCCGATAATTTTGTGTTTGGGCAATCCGGGGCGGGTAATAATTGGGCTAAAGGGCATTATACCGAGGGAGCTGAATTGATTGATTCTGTTCTTGATGTTGTTAGGAAAGAGGCTGAGAATTGTGATTGCTTGCAGGGTAAGAGTTTAAAGATCGTTTTCTGTTATGTTTATTGA

Network for GWHGAAZE004378

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00091.26	Tubulin	3	132	1.20E-36

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07375	TUBB	Phagosome	map04145
K07375	TUBB	Gap junction	map04540

Gene Ontology

GO term	Ontology	Name
GO:0007017	biological_process	microtubule-based process
GO:0005874	cellular_component	microtubule
GO:0005200	molecular_function	structural constituent of cytoskeleton
GO:0005525	molecular_function	GTP binding
GO:0003924	molecular_function	GTPase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	124.486
	SRR3591706	second leaf	46.210
	SRR3591707	mature leaf	70.857
	SRR3591708	Shoot apex	55.764
	SRR3591709	Stem	100.396
	SRR3591710	White floral bud	325.100
	SRR3591711	White flower	117.883
	SRR3591712	Green floral bud	281.211
	SRR3591713	Yellow flower	109.648
SRP173429	SRR8316895	Juvenile bud stage	37.542
	SRR8316896	Juvenile bud stage	48.999
	SRR8316897	Juvenile bud stage	30.613
	SRR8316894	Third green stage	35.994
	SRR8316900	Third green stage	157.031
	SRR8316901	Third green stage	140.708
	SRR8316898	Complete white stage	35.328
	SRR8316899	Complete white stage	102.534
	SRR8316903	Complete white stage	63.378
	SRR8316902	Silver flowering stage	32.387
	SRR8316904	Silver flowering stage	48.604
	SRR8316905	Silver flowering stage	25.738
	SRR8316906	Gold flowering stage	101.938
	SRR8316907	Gold flowering stage	99.361
	SRR8316908	Gold flowering stage	112.407
SRP132670	SRR6706286	Control	178.535
	SRR6706287	Light intensity 50%	186.015
	SRR6706288	Light intensity 20%	183.664
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	72.372
	CNS0095593	Slightly white alabastrum(diploid) 2	77.343
	CNS0095594	Slightly white alabastrum(diploid) 3	63.410
	CNS0095595	Whole white alabastrum(diploid) 2	210.836
	CNS0095596	Whole white alabastrum(diploid) 3	242.495
	CNS0095597	Whole white alabastrum(diploid) 4	331.903
	CNS0095598	Silvery flower (diploied) 1	93.446
	CNS0095599	Silvery flower (diploied) 2	104.536
	CNS0095600	Silvery flower (diploied) 3	134.059
	CNS0095601	Golden flower (diploid) 1	85.764
	CNS0095602	Golden flower (diploid) 2	169.100
	CNS0095603	Golden flower (diploid) 3	171.599
	CNS0095604	Slightly white alabastrum(tetraploid) 1	151.710
	CNS0095605	Slightly white alabastrum(tetraploid) 2	147.419
	CNS0095606	Slightly white alabastrum(tetraploid) 3	166.150
	CNS0095607	Whole white alabastrum(tetraploid) 1	284.288
	CNS0095608	Whole white alabastrum(tetraploid) 2	325.901
	CNS0095609	Whole white alabastrum(tetraploid) 3	241.778
	CNS0095610	Silvery flower (tetraploid) 1	147.055
	CNS0095611	Silvery flower (tetraploid) 2	169.786
	CNS0095612	Silvery flower (tetraploid) 3	169.058
	CNS0095613	Golden flower (tetraploid) 1	92.965
	CNS0095614	Golden flower (tetraploid) 2	131.239
	CNS0095615	Golden flower (tetraploid) 3	181.405
CRA001975	CRR073297	Stem 1	108.247
	CRR073298	Stem 2	93.437
	CRR073299	Stem 3	109.591
	CRR073300	Leaf 1	259.863
	CRR073301	Leaf 2	166.536
	CRR073302	Leaf 3	163.942
	CRR073303	Juvenile bud 1	268.111
	CRR073304	Juvenile bud 2	244.282
	CRR073305	Juvenile bud 3	171.823
	CRR073306	Third green 1	159.603
	CRR073307	Third green 2	186.879
	CRR073308	Third green 3	175.470
	CRR073309	Second white 1	183.758
	CRR073310	Second white 2	127.126
	CRR073311	Second white 3	135.474
	CRR073312	Silver flowering 1	217.689
	CRR073313	Silver flowering 2	282.691
	CRR073314	Silver flowering 3	196.896
	CRR073315	Gold flowering 1	96.206
	CRR073316	Gold flowering 2	96.088
	CRR073317	Gold flowering 3	103.590
	CRR073318	Tawny withering 1	155.160
	CRR073319	Tawny withering 2	116.560
	CRR073320	Tawny withering 3	159.166