Gene detail

Detail information of GWHGAAZE004293

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU35384.1	8.24205E-89	hypothetical protein MIMGU_mgv1a012138mg [Erythranthe guttata]
COG	YP_004689413.1	5E-17	50S ribosomal protein L7/L12
Swissprot	tr\|Q1XDE8\|RK12_PYRYE	2E-17	50S ribosomal protein L12, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_00368}
trEMBL	tr\|A0A022R5W6\|A0A022R5W6_ERYGU	3E-89	Uncharacterized protein {ECO:0000313\|EMBL:EYU35384.1}
TAIR10	AT1G70190.2	3E-54	Ribosomal protein L7/L12, oligomerisation;Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	114689525	114690013	-
GWHAAZE00000001	mRNA	114689525	114690013	-
GWHAAZE00000001	exon	114689525	114690013	-
GWHAAZE00000001	CDS	114689525	114690013	-

Transcript Sequence
>GWHTAAZE004299 GAAATTGATCAAAGAAGGCTCCCGGCTGATTATGACCCTGCAACTTTCGATCCCACACAGCACCGTAGCCCTCCAACTGAGCGTGTATGGAGGCTCGTAGACGAGATATCGGCTCTCACATTGATCGAAGTTGCGGAATTATCTTCGATTATGATGAAGAAATTGGGCATGAAGGAGATGCCTATAGTTGGGGTGATGAAACCCGGGGCCGCTGGATTGGCAATGAAATCAGGAACGACGGCGGCGGCGGCTAAGGAAGAGAAGAAACCAGAAAAGACCGTTTTCGAATTGAAATTGGAGTCTTATGAGGCGGCTTCGAAGATTAAGATAATCAAGGAGGTGAGGAGTTTTACCGAATTGGGGCTTAAGGAAGCGAAGGACTTGGTGGAGAAGACCCCTGCGGTGATTAAAAAGGGGGTTTCGAAAGAAGAAGGAGAGCAAATAATTGAGAAGATGAAGGCTATTGGGGCTAAAGTTGTTCTTGAATGA

Network for GWHGAAZE004293

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF16320.6	Ribosomal_L12_N	32	72	3.00E-06
PF00542.20	Ribosomal_L12	95	161	1.30E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02935	RP-L7, MRPL12, rplL	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	26.150
	SRR3591706	second leaf	20.468
	SRR3591707	mature leaf	25.313
	SRR3591708	Shoot apex	32.872
	SRR3591709	Stem	29.192
	SRR3591710	White floral bud	27.312
	SRR3591711	White flower	47.036
	SRR3591712	Green floral bud	58.532
	SRR3591713	Yellow flower	32.832
SRP173429	SRR8316895	Juvenile bud stage	32.783
	SRR8316896	Juvenile bud stage	39.840
	SRR8316897	Juvenile bud stage	14.182
	SRR8316894	Third green stage	19.381
	SRR8316900	Third green stage	58.883
	SRR8316901	Third green stage	54.860
	SRR8316898	Complete white stage	17.150
	SRR8316899	Complete white stage	67.832
	SRR8316903	Complete white stage	24.056
	SRR8316902	Silver flowering stage	15.755
	SRR8316904	Silver flowering stage	21.702
	SRR8316905	Silver flowering stage	13.222
	SRR8316906	Gold flowering stage	35.193
	SRR8316907	Gold flowering stage	32.727
	SRR8316908	Gold flowering stage	32.608
SRP132670	SRR6706286	Control	68.720
	SRR6706287	Light intensity 50%	60.235
	SRR6706288	Light intensity 20%	61.532
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	62.543
	CNS0095593	Slightly white alabastrum(diploid) 2	48.720
	CNS0095594	Slightly white alabastrum(diploid) 3	62.739
	CNS0095595	Whole white alabastrum(diploid) 2	34.687
	CNS0095596	Whole white alabastrum(diploid) 3	39.759
	CNS0095597	Whole white alabastrum(diploid) 4	27.557
	CNS0095598	Silvery flower (diploied) 1	34.270
	CNS0095599	Silvery flower (diploied) 2	30.923
	CNS0095600	Silvery flower (diploied) 3	40.063
	CNS0095601	Golden flower (diploid) 1	25.324
	CNS0095602	Golden flower (diploid) 2	30.202
	CNS0095603	Golden flower (diploid) 3	25.669
	CNS0095604	Slightly white alabastrum(tetraploid) 1	47.281
	CNS0095605	Slightly white alabastrum(tetraploid) 2	42.512
	CNS0095606	Slightly white alabastrum(tetraploid) 3	64.162
	CNS0095607	Whole white alabastrum(tetraploid) 1	26.112
	CNS0095608	Whole white alabastrum(tetraploid) 2	27.914
	CNS0095609	Whole white alabastrum(tetraploid) 3	55.476
	CNS0095610	Silvery flower (tetraploid) 1	38.795
	CNS0095611	Silvery flower (tetraploid) 2	33.390
	CNS0095612	Silvery flower (tetraploid) 3	22.410
	CNS0095613	Golden flower (tetraploid) 1	21.029
	CNS0095614	Golden flower (tetraploid) 2	32.705
	CNS0095615	Golden flower (tetraploid) 3	15.300
CRA001975	CRR073297	Stem 1	37.366
	CRR073298	Stem 2	52.458
	CRR073299	Stem 3	43.963
	CRR073300	Leaf 1	55.908
	CRR073301	Leaf 2	61.146
	CRR073302	Leaf 3	68.804
	CRR073303	Juvenile bud 1	59.135
	CRR073304	Juvenile bud 2	70.662
	CRR073305	Juvenile bud 3	65.354
	CRR073306	Third green 1	17.604
	CRR073307	Third green 2	21.582
	CRR073308	Third green 3	17.033
	CRR073309	Second white 1	24.085
	CRR073310	Second white 2	15.348
	CRR073311	Second white 3	14.461
	CRR073312	Silver flowering 1	12.343
	CRR073313	Silver flowering 2	13.277
	CRR073314	Silver flowering 3	11.495
	CRR073315	Gold flowering 1	20.668
	CRR073316	Gold flowering 2	22.904
	CRR073317	Gold flowering 3	22.889
	CRR073318	Tawny withering 1	35.770
	CRR073319	Tawny withering 2	54.622
	CRR073320	Tawny withering 3	31.385