Gene detail

Detail information of GWHGAAZE004275

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP11225.1	1.396E-67	unnamed protein product [Coffea canephora]
trEMBL	tr\|A0A068URU2\|A0A068URU2_COFCA	5E-68	Coffea canephora DH200=94 genomic scaffold, scaffold_53 {ECO:0000313\|EMBL:CDP11225.1}
TAIR10	AT2G39440.1	2E-48	Without detailed annotation

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	114385401	114388160	+
GWHAAZE00000001	mRNA	114385401	114388160	+
GWHAAZE00000001	exon	114385401	114385563	+
GWHAAZE00000001	exon	114385660	114385752	+
GWHAAZE00000001	exon	114387931	114388160	+
GWHAAZE00000001	CDS	114385401	114385563	+
GWHAAZE00000001	CDS	114385660	114385752	+
GWHAAZE00000001	CDS	114387931	114388160	+

Transcript Sequence
>GWHTAAZE004281 ATGGATGGCAACAGTGGTTCGGAGGTGGGAACCGCCGGGAGCATCGATCTGAGAGGTGGGGAATCGGCGGTGGATCTGACGGGTCAGATTCATCAGCTTCCATGCTGCATCAAATACGATGGACCTTGCGCTGTTTCTCACTACTTTAAACCCAAATCCACCGGGGTTGAGGTTGATGGTCTAAGTATGAAGGAAGCTCACTTCAGAGGAAGGAAGTTGCAAGGCACCACTATTCCCCTTCCTCAAGGCTATTCTGGTTTTGTCATAGGAAAGAAAAGTTCCGACAAGAGAAAAGCTTCTGATATGTCGGAAGAGAAACCCAATAATTGGGAAATGAATGCCAAATTCAAAGACATAACATACTGGAATCACGATAGTCTTCCTTCTCAAGATGATGCTTTCTTGCGTTCCTTTCACTGGTTTACCATTGCAGAAGCAGTAAGTTTTAGCCATATTCATTCATGGAAGATGATGATATCTATATAA

Network for GWHGAAZE004275

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF08615.12	RNase_H2_suC	30	147	3.30E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K10745	RNASEH2C	DNA replication	map03030

Gene Ontology

GO term	Ontology	Name
GO:0006401	biological_process	RNA catabolic process
GO:0032299	cellular_component	ribonuclease H2 complex

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	14.621
	SRR3591706	second leaf	7.549
	SRR3591707	mature leaf	10.793
	SRR3591708	Shoot apex	21.623
	SRR3591709	Stem	15.837
	SRR3591710	White floral bud	11.077
	SRR3591711	White flower	19.441
	SRR3591712	Green floral bud	13.732
	SRR3591713	Yellow flower	22.227
SRP173429	SRR8316895	Juvenile bud stage	21.234
	SRR8316896	Juvenile bud stage	31.834
	SRR8316897	Juvenile bud stage	11.469
	SRR8316894	Third green stage	11.819
	SRR8316900	Third green stage	35.662
	SRR8316901	Third green stage	40.359
	SRR8316898	Complete white stage	14.540
	SRR8316899	Complete white stage	48.739
	SRR8316903	Complete white stage	22.309
	SRR8316902	Silver flowering stage	21.027
	SRR8316904	Silver flowering stage	20.401
	SRR8316905	Silver flowering stage	10.105
	SRR8316906	Gold flowering stage	40.988
	SRR8316907	Gold flowering stage	41.613
	SRR8316908	Gold flowering stage	33.703
SRP132670	SRR6706286	Control	25.473
	SRR6706287	Light intensity 50%	23.363
	SRR6706288	Light intensity 20%	25.395
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	48.232
	CNS0095593	Slightly white alabastrum(diploid) 2	61.162
	CNS0095594	Slightly white alabastrum(diploid) 3	52.619
	CNS0095595	Whole white alabastrum(diploid) 2	49.418
	CNS0095596	Whole white alabastrum(diploid) 3	57.322
	CNS0095597	Whole white alabastrum(diploid) 4	50.651
	CNS0095598	Silvery flower (diploied) 1	48.591
	CNS0095599	Silvery flower (diploied) 2	42.444
	CNS0095600	Silvery flower (diploied) 3	36.600
	CNS0095601	Golden flower (diploid) 1	54.010
	CNS0095602	Golden flower (diploid) 2	40.248
	CNS0095603	Golden flower (diploid) 3	39.498
	CNS0095604	Slightly white alabastrum(tetraploid) 1	47.913
	CNS0095605	Slightly white alabastrum(tetraploid) 2	53.614
	CNS0095606	Slightly white alabastrum(tetraploid) 3	44.246
	CNS0095607	Whole white alabastrum(tetraploid) 1	40.701
	CNS0095608	Whole white alabastrum(tetraploid) 2	39.419
	CNS0095609	Whole white alabastrum(tetraploid) 3	45.460
	CNS0095610	Silvery flower (tetraploid) 1	49.266
	CNS0095611	Silvery flower (tetraploid) 2	44.485
	CNS0095612	Silvery flower (tetraploid) 3	39.191
	CNS0095613	Golden flower (tetraploid) 1	54.799
	CNS0095614	Golden flower (tetraploid) 2	64.943
	CNS0095615	Golden flower (tetraploid) 3	47.597
CRA001975	CRR073297	Stem 1	26.128
	CRR073298	Stem 2	27.499
	CRR073299	Stem 3	30.349
	CRR073300	Leaf 1	34.941
	CRR073301	Leaf 2	26.253
	CRR073302	Leaf 3	29.041
	CRR073303	Juvenile bud 1	33.405
	CRR073304	Juvenile bud 2	21.781
	CRR073305	Juvenile bud 3	16.177
	CRR073306	Third green 1	18.133
	CRR073307	Third green 2	20.608
	CRR073308	Third green 3	13.822
	CRR073309	Second white 1	20.727
	CRR073310	Second white 2	25.261
	CRR073311	Second white 3	16.198
	CRR073312	Silver flowering 1	10.861
	CRR073313	Silver flowering 2	9.432
	CRR073314	Silver flowering 3	11.361
	CRR073315	Gold flowering 1	21.940
	CRR073316	Gold flowering 2	21.462
	CRR073317	Gold flowering 3	16.614
	CRR073318	Tawny withering 1	23.057
	CRR073319	Tawny withering 2	36.897
	CRR073320	Tawny withering 3	23.130