Gene detail

Detail information of GWHGAAZE004226

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007202706.1	1.13396E-80	hypothetical protein PRUPE_ppa012725mg [Prunus persica]
COG	YP_003290884.1	2E-30	Superoxide dismutase
Swissprot	tr\|O49044\|SODC2_MESCR	2E-79	Superoxide dismutase [Cu-Zn] 2
trEMBL	tr\|M5WAT2\|M5WAT2_PRUPE	4E-81	Superoxide dismutase [Cu-Zn] {ECO:0000256\|RuleBase:RU000393}
TAIR10	AT5G18100.1	1E-55	copper/zinc superoxide dismutase 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	113589184	113592267	+
GWHAAZE00000001	mRNA	113589184	113592267	+
GWHAAZE00000001	exon	113589184	113589265	+
GWHAAZE00000001	exon	113589369	113589452	+
GWHAAZE00000001	exon	113590790	113590885	+
GWHAAZE00000001	exon	113591004	113591035	+
GWHAAZE00000001	exon	113591607	113591682	+
GWHAAZE00000001	exon	113592119	113592267	+
GWHAAZE00000001	CDS	113589184	113589265	+
GWHAAZE00000001	CDS	113589369	113589452	+
GWHAAZE00000001	CDS	113590790	113590885	+
GWHAAZE00000001	CDS	113591004	113591035	+
GWHAAZE00000001	CDS	113591607	113591682	+
GWHAAZE00000001	CDS	113592119	113592267	+

Transcript Sequence
>GWHTAAZE004232 ATGGTTATGGTGAAAGCGGTAGCTATAATCACCGGCAATTCCAACGTTACAGGCTCTCTCCAATTTGTTCAAGACTCCAATGGGAGGATTAGAGGGCTAAGTCCAGGGCAACATGGGTTTCATATTCATGCTCTTGGTGATACCACCAATGGTTGCAATTCCACTGGTCCTCATTTTAATCCACTAAAGAAGAACCATGGAGCTCCTACAGAGGAGGAGCGTCATGCTGGTGATTTGGGCAATGTTGTTGCAGGCCCAGATGGAGTTGCTGAAGTTTCAATTAAAGACACAAAGATTCCGTTAACTGGGCAGCATTCCATTTTGGGGAGGGCGGTTGTTGTGCATGCTGATCCTGATGATCTTGGGAGAGGTGGCCATGAGCTTAGCAAGACAACGGGAAACGCAGGTGCAAGAGTTGGCTGTGGTAATTCCTTTTCTTCCCTCCTATTATTCTATCTTTTTTTTATTATTATCTAGTTTATCAACCTTTTTATTTATTTATTATTTTGTCGTGGATAG

Network for GWHGAAZE004226

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00080.21	Sod_Cu	12	143	2.20E-42

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K04565	SOD1	Peroxisome	map04146
K04565	SOD1	Longevity regulating pathway - multiple species	map04213

Gene Ontology

GO term	Ontology	Name
GO:0006801	biological_process	superoxide metabolic process
GO:0055114	biological_process	oxidation-reduction process
GO:0046872	molecular_function	metal ion binding
GO:0004784	molecular_function	superoxide dismutase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	30.694
	SRR3591706	second leaf	32.964
	SRR3591707	mature leaf	48.078
	SRR3591708	Shoot apex	23.666
	SRR3591709	Stem	26.302
	SRR3591710	White floral bud	10.053
	SRR3591711	White flower	12.881
	SRR3591712	Green floral bud	15.257
	SRR3591713	Yellow flower	14.724
SRP173429	SRR8316895	Juvenile bud stage	17.052
	SRR8316896	Juvenile bud stage	20.841
	SRR8316897	Juvenile bud stage	8.266
	SRR8316894	Third green stage	9.380
	SRR8316900	Third green stage	27.148
	SRR8316901	Third green stage	29.172
	SRR8316898	Complete white stage	9.564
	SRR8316899	Complete white stage	30.033
	SRR8316903	Complete white stage	11.401
	SRR8316902	Silver flowering stage	4.712
	SRR8316904	Silver flowering stage	5.145
	SRR8316905	Silver flowering stage	2.177
	SRR8316906	Gold flowering stage	10.459
	SRR8316907	Gold flowering stage	13.501
	SRR8316908	Gold flowering stage	7.459
SRP132670	SRR6706286	Control	43.696
	SRR6706287	Light intensity 50%	37.282
	SRR6706288	Light intensity 20%	42.533
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	25.076
	CNS0095593	Slightly white alabastrum(diploid) 2	27.772
	CNS0095594	Slightly white alabastrum(diploid) 3	23.558
	CNS0095595	Whole white alabastrum(diploid) 2	25.819
	CNS0095596	Whole white alabastrum(diploid) 3	25.773
	CNS0095597	Whole white alabastrum(diploid) 4	22.201
	CNS0095598	Silvery flower (diploied) 1	37.307
	CNS0095599	Silvery flower (diploied) 2	30.508
	CNS0095600	Silvery flower (diploied) 3	22.806
	CNS0095601	Golden flower (diploid) 1	25.575
	CNS0095602	Golden flower (diploid) 2	24.953
	CNS0095603	Golden flower (diploid) 3	27.646
	CNS0095604	Slightly white alabastrum(tetraploid) 1	29.460
	CNS0095605	Slightly white alabastrum(tetraploid) 2	25.895
	CNS0095606	Slightly white alabastrum(tetraploid) 3	34.008
	CNS0095607	Whole white alabastrum(tetraploid) 1	15.370
	CNS0095608	Whole white alabastrum(tetraploid) 2	19.672
	CNS0095609	Whole white alabastrum(tetraploid) 3	22.428
	CNS0095610	Silvery flower (tetraploid) 1	21.427
	CNS0095611	Silvery flower (tetraploid) 2	17.918
	CNS0095612	Silvery flower (tetraploid) 3	13.240
	CNS0095613	Golden flower (tetraploid) 1	19.161
	CNS0095614	Golden flower (tetraploid) 2	19.072
	CNS0095615	Golden flower (tetraploid) 3	9.714
CRA001975	CRR073297	Stem 1	27.704
	CRR073298	Stem 2	30.186
	CRR073299	Stem 3	28.934
	CRR073300	Leaf 1	30.055
	CRR073301	Leaf 2	33.117
	CRR073302	Leaf 3	36.152
	CRR073303	Juvenile bud 1	33.219
	CRR073304	Juvenile bud 2	22.093
	CRR073305	Juvenile bud 3	38.703
	CRR073306	Third green 1	6.227
	CRR073307	Third green 2	5.949
	CRR073308	Third green 3	3.774
	CRR073309	Second white 1	7.714
	CRR073310	Second white 2	3.716
	CRR073311	Second white 3	4.501
	CRR073312	Silver flowering 1	3.479
	CRR073313	Silver flowering 2	3.526
	CRR073314	Silver flowering 3	1.722
	CRR073315	Gold flowering 1	63.520
	CRR073316	Gold flowering 2	61.058
	CRR073317	Gold flowering 3	55.131
	CRR073318	Tawny withering 1	29.379
	CRR073319	Tawny withering 2	34.352
	CRR073320	Tawny withering 3	24.507