Gene detail

Detail information of GWHGAAZE004224

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011075059.1	5.75861E-29	PREDICTED: ethylene-responsive transcription factor RAP2-11-like [Sesamum indicum]
Swissprot	tr\|Q6J9S1\|RA211_ARATH	9E-21	Ethylene-responsive transcription factor RAP2-11
trEMBL	tr\|W9RCL9\|W9RCL9_9ROSA	3E-29	Ethylene-responsive transcription factor {ECO:0000313\|EMBL:EXB68020.1}
TAIR10	AT5G19790.1	0.0000001	related to AP2 11

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	113581546	113581788	+
GWHAAZE00000001	mRNA	113581546	113581788	+
GWHAAZE00000001	exon	113581546	113581788	+
GWHAAZE00000001	CDS	113581546	113581788	+

Transcript Sequence
>GWHTAAZE004230 ATGTGGCTTGGAACCTTTGAAACTGCCGAAGAAGCTGCACGCGCTTATGATGAAGCAGCCTGCCTTCTTCGCGGATCAAACACGCGTACAAATTTCATCACGAACGTATCTGCCAATTCCCCTCTTGCTTCAAGGATTCAAAGTCTCCTCAACAGCAAGAAAACTGCTGCCAAACAGCAGAAAACAGAGTCCTCTGTTTCTGCCTCTACTCCCAAGCAGCAGAAAACAGAGTCCTCTGTTTCT

Network for GWHGAAZE004224

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	2	25	3.40E-05

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.488
	SRR3591708	Shoot apex	0.370
	SRR3591709	Stem	0.624
	SRR3591710	White floral bud	1.120
	SRR3591711	White flower	0.049
	SRR3591712	Green floral bud	0.489
	SRR3591713	Yellow flower	0.728
SRP173429	SRR8316895	Juvenile bud stage	0.358
	SRR8316896	Juvenile bud stage	0.628
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.077
	SRR8316898	Complete white stage	0.236
	SRR8316899	Complete white stage	0.114
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.121
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.360
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.239
SRP132670	SRR6706286	Control	0.625
	SRR6706287	Light intensity 50%	0.093
	SRR6706288	Light intensity 20%	0.195
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.527
	CNS0095594	Slightly white alabastrum(diploid) 3	0.670
	CNS0095595	Whole white alabastrum(diploid) 2	0.501
	CNS0095596	Whole white alabastrum(diploid) 3	0.161
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.141
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	1.142
	CNS0095603	Golden flower (diploid) 3	0.445
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.130
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.322
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.061
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.686
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.426
	CNS0095611	Silvery flower (tetraploid) 2	0.006
	CNS0095612	Silvery flower (tetraploid) 3	0.185
	CNS0095613	Golden flower (tetraploid) 1	0.163
	CNS0095614	Golden flower (tetraploid) 2	0.241
	CNS0095615	Golden flower (tetraploid) 3	0.217
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.131
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.489
	CRR073301	Leaf 2	0.361
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.994
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	1.000
	CRR073307	Third green 2	0.406
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.296
	CRR073313	Silver flowering 2	0.873
	CRR073314	Silver flowering 3	3.083
	CRR073315	Gold flowering 1	1.264
	CRR073316	Gold flowering 2	1.148
	CRR073317	Gold flowering 3	2.285
	CRR073318	Tawny withering 1	0.493
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.152