Gene detail

Detail information of GWHGAAZE004042

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_003634222.1	3.7537E-32	PREDICTED: omega-hydroxypalmitate O-feruloyl transferase [Vitis vinifera]
Swissprot	tr\|Q94CD1\|HHT1_ARATH	3E-28	Omega-hydroxypalmitate O-feruloyl transferase
trEMBL	tr\|F6GSZ7\|F6GSZ7_VITVI	4E-33	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB43342.1}
TAIR10	AT5G41040.1	5E-25	HXXXD-type acyl-transferase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	109850448	109851053	+
GWHAAZE00000001	mRNA	109850448	109851053	+
GWHAAZE00000001	exon	109850448	109851053	+
GWHAAZE00000001	CDS	109850448	109851053	+

Transcript Sequence
>GWHTAAZE004048 ATGAAGACTGATTCCAACATAATCTCCAAAATTTCTGAAGAAGAAACACAAAAGCTGATAGTGAAGCTAGGAGATGCCATTTTAGTTCCACCAGAACAAGAAACACACAAGGGTACCCTATACTTTCTCTCGAATCTCAACCAAAACTTTCCCACAATAGTTCGCACAATTTACTGCTATGACAAATACGAAGGCAAATCCAGTGAGACCGCATGTAGGTTAATTAGGGATCCGTTATCGAAGATTCTGGACCATTATTACCAGCAAGCCGGGCAGCTCGTGGTGGGCTCGGAACAGAAGCTGGCAGTGGAGTGTACCAGCCAAGGAGGGGTTTTCGTTGAGGCAGAAGCTTATTATACCCTACAAGTTATTATTGACGAGAACGGAGTGCCTCATCCTTCTATCCATGGGAAGCTAGTTTACCACTTTGCTGGTGCCAATGACACACTTGGCACTTGTGACTATCTTCCCCTCCTAGTCAGTACCAGTAATGAACTAATGATACATTTTCTCCTGTCTTATGATAGACATGATGAGCCAATGCTTCTTCAAAGTTTTGCAATAAAATCCAAAGTTGAGACTGGTACACAAATTTGGTTTAATTAA

Network for GWHGAAZE004042

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02458.16	Transferase	28	134	9.50E-17

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K15400	HHT1	Cutin, suberine and wax biosynthesis	map00073

Gene Ontology

GO term	Ontology	Name
GO:0016747	molecular_function	transferase activity, transferring acyl groups other than amino-acyl groups

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.978
	SRR3591706	second leaf	1.057
	SRR3591707	mature leaf	1.127
	SRR3591708	Shoot apex	2.004
	SRR3591709	Stem	2.844
	SRR3591710	White floral bud	1.669
	SRR3591711	White flower	2.651
	SRR3591712	Green floral bud	2.546
	SRR3591713	Yellow flower	2.445
SRP173429	SRR8316895	Juvenile bud stage	2.515
	SRR8316896	Juvenile bud stage	2.831
	SRR8316897	Juvenile bud stage	0.316
	SRR8316894	Third green stage	1.642
	SRR8316900	Third green stage	2.553
	SRR8316901	Third green stage	3.446
	SRR8316898	Complete white stage	1.076
	SRR8316899	Complete white stage	3.019
	SRR8316903	Complete white stage	2.370
	SRR8316902	Silver flowering stage	1.218
	SRR8316904	Silver flowering stage	1.581
	SRR8316905	Silver flowering stage	0.876
	SRR8316906	Gold flowering stage	1.791
	SRR8316907	Gold flowering stage	0.892
	SRR8316908	Gold flowering stage	1.541
SRP132670	SRR6706286	Control	2.264
	SRR6706287	Light intensity 50%	1.186
	SRR6706288	Light intensity 20%	1.341
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.510
	CNS0095593	Slightly white alabastrum(diploid) 2	5.015
	CNS0095594	Slightly white alabastrum(diploid) 3	5.109
	CNS0095595	Whole white alabastrum(diploid) 2	4.836
	CNS0095596	Whole white alabastrum(diploid) 3	3.536
	CNS0095597	Whole white alabastrum(diploid) 4	4.850
	CNS0095598	Silvery flower (diploied) 1	3.298
	CNS0095599	Silvery flower (diploied) 2	4.396
	CNS0095600	Silvery flower (diploied) 3	1.686
	CNS0095601	Golden flower (diploid) 1	2.695
	CNS0095602	Golden flower (diploid) 2	2.190
	CNS0095603	Golden flower (diploid) 3	1.444
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.679
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.455
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.775
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.702
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.719
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.657
	CNS0095610	Silvery flower (tetraploid) 1	0.311
	CNS0095611	Silvery flower (tetraploid) 2	0.557
	CNS0095612	Silvery flower (tetraploid) 3	0.211
	CNS0095613	Golden flower (tetraploid) 1	0.465
	CNS0095614	Golden flower (tetraploid) 2	0.469
	CNS0095615	Golden flower (tetraploid) 3	0.415
CRA001975	CRR073297	Stem 1	2.264
	CRR073298	Stem 2	2.551
	CRR073299	Stem 3	1.644
	CRR073300	Leaf 1	2.412
	CRR073301	Leaf 2	1.845
	CRR073302	Leaf 3	0.245
	CRR073303	Juvenile bud 1	0.516
	CRR073304	Juvenile bud 2	0.568
	CRR073305	Juvenile bud 3	1.336
	CRR073306	Third green 1	0.482
	CRR073307	Third green 2	1.056
	CRR073308	Third green 3	0.109
	CRR073309	Second white 1	0.221
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.388
	CRR073312	Silver flowering 1	0.294
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.084
	CRR073315	Gold flowering 1	0.408
	CRR073316	Gold flowering 2	0.304
	CRR073317	Gold flowering 3	0.101
	CRR073318	Tawny withering 1	0.959
	CRR073319	Tawny withering 2	1.236
	CRR073320	Tawny withering 3	0.727