Gene detail

Detail information of GWHGAAZE003914

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP12647.1	4.62794E-83	unnamed protein product [Coffea canephora]
Swissprot	tr\|P81392\|MYB06_ANTMA	5E-79	Myb-related protein 306
trEMBL	tr\|A0A068UWH9\|A0A068UWH9_COFCA	2E-83	Coffea canephora DH200=94 genomic scaffold, scaffold_69 {ECO:0000313\|EMBL:CDP12647.1}
TAIR10	AT1G08810.1	1E-66	myb domain protein 60

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	106950950	106952215	+
GWHAAZE00000001	mRNA	106950950	106952215	+
GWHAAZE00000001	exon	106950950	106951082	+
GWHAAZE00000001	exon	106951407	106951536	+
GWHAAZE00000001	exon	106952125	106952215	+
GWHAAZE00000001	CDS	106950950	106951082	+
GWHAAZE00000001	CDS	106951407	106951536	+
GWHAAZE00000001	CDS	106952125	106952215	+

Transcript Sequence
>GWHTAAZE003920 ATGGGGAGGCCACCATGCTGTGACAAAGTAGGAGTGAAGAAAGGTCCATGGACACCAGAAGAAGACATCATCTTAGTGTCTTACATCCAAGATCACGGTCCCGGTAACTGGCGATCCGTGCCTACTAACACCGGGTTGTTAAGGTGCAGCAAAAGTTGTAGGCTTAGATGGACAAATTACTTGAGACCTGGAATTAAGAGGGGTAATTTCACCCCACATGAAGAAGGCATGATTATCCATCTCCAAGCTTTGCTTGGTAACAAATGGGCAGCCATAGCTTCATACCTGCCGCAAAGAACAGATAACGATATAAAGAATTACTGGAACACGCACTTGAAGAAGAAGATAAAGAGG

Network for GWHGAAZE003914

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00249.32	Myb_DNA-binding	14	61	1.30E-14
PF00249.32	Myb_DNA-binding	67	112	7.50E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MYB

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.512
	SRR3591706	second leaf	44.455
	SRR3591707	mature leaf	76.724
	SRR3591708	Shoot apex	12.760
	SRR3591709	Stem	2.686
	SRR3591710	White floral bud	5.850
	SRR3591711	White flower	8.055
	SRR3591712	Green floral bud	1.900
	SRR3591713	Yellow flower	8.801
SRP173429	SRR8316895	Juvenile bud stage	1.362
	SRR8316896	Juvenile bud stage	1.298
	SRR8316897	Juvenile bud stage	0.500
	SRR8316894	Third green stage	1.817
	SRR8316900	Third green stage	1.712
	SRR8316901	Third green stage	0.558
	SRR8316898	Complete white stage	0.383
	SRR8316899	Complete white stage	1.149
	SRR8316903	Complete white stage	1.286
	SRR8316902	Silver flowering stage	0.644
	SRR8316904	Silver flowering stage	0.892
	SRR8316905	Silver flowering stage	0.522
	SRR8316906	Gold flowering stage	2.846
	SRR8316907	Gold flowering stage	3.744
	SRR8316908	Gold flowering stage	9.587
SRP132670	SRR6706286	Control	2.772
	SRR6706287	Light intensity 50%	1.520
	SRR6706288	Light intensity 20%	1.454
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.114
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.249
	CNS0095596	Whole white alabastrum(diploid) 3	0.451
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	4.244
	CNS0095599	Silvery flower (diploied) 2	0.570
	CNS0095600	Silvery flower (diploied) 3	1.603
	CNS0095601	Golden flower (diploid) 1	1.367
	CNS0095602	Golden flower (diploid) 2	4.694
	CNS0095603	Golden flower (diploid) 3	5.314
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.064
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.875
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.499
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.274
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.541
	CNS0095610	Silvery flower (tetraploid) 1	19.608
	CNS0095611	Silvery flower (tetraploid) 2	10.252
	CNS0095612	Silvery flower (tetraploid) 3	8.870
	CNS0095613	Golden flower (tetraploid) 1	18.862
	CNS0095614	Golden flower (tetraploid) 2	19.058
	CNS0095615	Golden flower (tetraploid) 3	12.032
CRA001975	CRR073297	Stem 1	3.179
	CRR073298	Stem 2	2.458
	CRR073299	Stem 3	1.044
	CRR073300	Leaf 1	1.055
	CRR073301	Leaf 2	1.582
	CRR073302	Leaf 3	0.191
	CRR073303	Juvenile bud 1	0.657
	CRR073304	Juvenile bud 2	0.334
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.065
	CRR073308	Third green 3	1.014
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	1.180
	CRR073311	Second white 3	0.953
	CRR073312	Silver flowering 1	0.521
	CRR073313	Silver flowering 2	0.489
	CRR073314	Silver flowering 3	0.048
	CRR073315	Gold flowering 1	22.310
	CRR073316	Gold flowering 2	24.907
	CRR073317	Gold flowering 3	18.332
	CRR073318	Tawny withering 1	4.720
	CRR073319	Tawny withering 2	2.670
	CRR073320	Tawny withering 3	4.752